Incidental Mutation 'R1199:Lpp'
ID101251
Institutional Source Beutler Lab
Gene Symbol Lpp
Ensembl Gene ENSMUSG00000033306
Gene NameLIM domain containing preferred translocation partner in lipoma
SynonymsB130055L10Rik, 9430020K16Rik
MMRRC Submission 039269-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R1199 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location24393507-24992578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24681860 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 141 (R141C)
Ref Sequence ENSEMBL: ENSMUSP00000078005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038053] [ENSMUST00000078988]
Predicted Effect probably damaging
Transcript: ENSMUST00000038053
AA Change: R141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036304
Gene: ENSMUSG00000033306
AA Change: R141C

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078988
AA Change: R141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078005
Gene: ENSMUSG00000033306
AA Change: R141C

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231352
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM domain proteins that are characterized by an N-terminal proline-rich region and three C-terminal LIM domains. The encoded protein localizes to the cell periphery in focal adhesions and may be involved in cell-cell adhesion and cell motility. This protein also shuttles through the nucleus and may function as a transcriptional co-activator. This gene is located at the junction of certain disease-related chromosomal translocations, which result in the expression of chimeric proteins that may promote tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Gene disruption results in fertility problems involving females but not males. Migration and survival of MEFs are also abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,393,477 H80L possibly damaging Het
A1bg A T 15: 60,919,635 probably null Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Agrn T A 4: 156,172,299 Y1283F probably benign Het
Akap6 T C 12: 52,796,190 V107A probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Btnl9 A T 11: 49,180,747 V83E probably damaging Het
Camk2a T A 18: 60,952,324 C131* probably null Het
Ccdc14 C T 16: 34,723,828 T852M probably damaging Het
Cntn4 T C 6: 106,353,597 probably benign Het
Cp T G 3: 19,977,152 S585R probably damaging Het
Cpt1b G A 15: 89,419,010 A614V probably benign Het
Crygn T C 5: 24,751,148 Y153C probably damaging Het
Dennd1a A T 2: 37,961,716 D53E probably damaging Het
Deptor T C 15: 55,252,010 C357R probably benign Het
Dnajc28 C A 16: 91,618,642 probably benign Het
Eml6 G A 11: 29,755,044 A1500V possibly damaging Het
Fgd5 T A 6: 91,986,978 L64Q possibly damaging Het
Fgfbp1 A G 5: 43,979,597 Y118H probably damaging Het
Ftcd G A 10: 76,579,819 R135H probably damaging Het
Gm5174 A T 10: 86,657,325 noncoding transcript Het
Gpr37l1 A T 1: 135,166,972 L178Q probably damaging Het
Gtf2ird1 A G 5: 134,411,064 V104A possibly damaging Het
Irs1 T A 1: 82,289,626 S290C probably damaging Het
Kel C T 6: 41,688,591 V532I possibly damaging Het
Kif1c A G 11: 70,708,601 E442G possibly damaging Het
Klhdc10 T A 6: 30,449,494 V185D probably damaging Het
Olfr1025-ps1 A G 2: 85,918,035 I37V probably benign Het
Olfr68 A T 7: 103,777,985 M120K probably damaging Het
Pcnx2 G T 8: 125,887,314 P466H possibly damaging Het
Pcsk1 A T 13: 75,096,413 probably benign Het
Pkd2l2 T C 18: 34,438,216 probably null Het
Pomt1 A G 2: 32,250,492 N454S probably benign Het
Samhd1 A T 2: 157,109,461 I452N probably damaging Het
Sez6 A G 11: 77,953,885 Q178R probably benign Het
Slc25a44 A G 3: 88,420,986 V66A probably damaging Het
Slc46a2 T C 4: 59,914,189 T245A probably benign Het
Slc4a4 G A 5: 89,215,794 probably null Het
Spata6 T A 4: 111,799,145 C329S possibly damaging Het
Srrm2 A T 17: 23,817,751 probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Svil T A 18: 5,059,217 probably benign Het
Tenm3 G T 8: 48,235,582 S2323R probably damaging Het
Tsc1 G A 2: 28,665,626 R245Q probably damaging Het
Ttn A G 2: 76,908,756 V3813A probably benign Het
Ttn G A 2: 76,950,044 T1121M possibly damaging Het
Ush2a G A 1: 188,759,795 V3094I probably benign Het
Vcan A G 13: 89,679,794 probably null Het
Vmn1r189 A T 13: 22,102,658 L3Q probably damaging Het
Vmn1r60 A C 7: 5,544,972 V43G probably damaging Het
Vmn2r110 A G 17: 20,583,263 I350T probably benign Het
Vmn2r86 T A 10: 130,448,574 probably benign Het
Xrn1 A G 9: 95,981,761 probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Lpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Lpp APN 16 24845188 missense probably damaging 1.00
IGL01354:Lpp APN 16 24762066 nonsense probably null
IGL02141:Lpp APN 16 24761615 missense probably damaging 0.98
IGL02182:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02230:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02232:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02234:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02236:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02371:Lpp APN 16 24761611 missense probably damaging 0.96
IGL03265:Lpp APN 16 24761987 missense probably damaging 1.00
PIT4585001:Lpp UTSW 16 24761947 missense probably benign 0.23
R0047:Lpp UTSW 16 24661800 splice site probably benign
R0047:Lpp UTSW 16 24661800 splice site probably benign
R0092:Lpp UTSW 16 24761602 missense probably benign 0.01
R0385:Lpp UTSW 16 24761837 missense probably damaging 1.00
R0389:Lpp UTSW 16 24608241 missense probably damaging 1.00
R0504:Lpp UTSW 16 24971970 missense probably damaging 1.00
R0798:Lpp UTSW 16 24971872 nonsense probably null
R1581:Lpp UTSW 16 24681841 nonsense probably null
R1755:Lpp UTSW 16 24845124 missense probably benign
R1848:Lpp UTSW 16 24761655 missense probably damaging 1.00
R1980:Lpp UTSW 16 24661701 missense probably damaging 1.00
R3432:Lpp UTSW 16 24889886 missense probably benign 0.04
R3755:Lpp UTSW 16 24845161 missense probably benign 0.00
R4078:Lpp UTSW 16 24681861 missense probably damaging 1.00
R4214:Lpp UTSW 16 24762054 nonsense probably null
R4712:Lpp UTSW 16 24761657 missense possibly damaging 0.94
R4806:Lpp UTSW 16 24661680 missense probably damaging 0.97
R4968:Lpp UTSW 16 24979314 missense probably damaging 1.00
R5047:Lpp UTSW 16 24971846 missense probably damaging 1.00
R5371:Lpp UTSW 16 24889804 missense probably damaging 1.00
R5536:Lpp UTSW 16 24845206 missense possibly damaging 0.54
R5875:Lpp UTSW 16 24608309 missense probably benign 0.10
R7285:Lpp UTSW 16 24977279 missense probably damaging 1.00
R7587:Lpp UTSW 16 24762279 splice site probably null
R7846:Lpp UTSW 16 24608126 start codon destroyed probably null 0.98
Z1176:Lpp UTSW 16 24761603 missense probably benign 0.00
Z1177:Lpp UTSW 16 24661712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGCAGAGGGCCTCAATTGTATG -3'
(R):5'- GGAAGGATGATGCTGACAATGCACC -3'

Sequencing Primer
(F):5'- aaggagagagggaaagggag -3'
(R):5'- CTTAGCATGACAGTGAATGTCTGC -3'
Posted On2014-01-15