Incidental Mutation 'R1199:Camk2a'
ID101265
Institutional Source Beutler Lab
Gene Symbol Camk2a
Ensembl Gene ENSMUSG00000024617
Gene Namecalcium/calmodulin-dependent protein kinase II alpha
Synonymsalpha-CaMKII
MMRRC Submission 039269-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R1199 (G1)
Quality Score189
Status Validated
Chromosome18
Chromosomal Location60925618-60988152 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 60952324 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 131 (C131*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025519] [ENSMUST00000102888]
Predicted Effect probably null
Transcript: ENSMUST00000025519
AA Change: C126*
SMART Domains Protein: ENSMUSP00000025519
Gene: ENSMUSG00000024617
AA Change: C126*

DomainStartEndE-ValueType
S_TKc 13 271 3.59e-107 SMART
low complexity region 314 344 N/A INTRINSIC
Pfam:CaMKII_AD 357 484 6.7e-68 PFAM
Pfam:DUF4440 361 475 2.6e-10 PFAM
Pfam:SnoaL_3 361 485 6e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102888
AA Change: C126*
SMART Domains Protein: ENSMUSP00000099952
Gene: ENSMUSG00000024617
AA Change: C126*

DomainStartEndE-ValueType
S_TKc 13 271 3.59e-107 SMART
low complexity region 314 324 N/A INTRINSIC
Pfam:CaMKII_AD 346 473 1.2e-66 PFAM
Pfam:DUF4440 350 464 4.5e-12 PFAM
Pfam:SnoaL_3 350 474 2.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137805
AA Change: C131*
SMART Domains Protein: ENSMUSP00000123480
Gene: ENSMUSG00000024617
AA Change: C131*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 20 176 1.8e-22 PFAM
Pfam:Pkinase 21 176 3.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183978
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinases family, and to the Ca(2+)/calmodulin-dependent protein kinases subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. This calcium calmodulin-dependent protein kinase is composed of four different chains: alpha, beta, gamma, and delta. The alpha chain encoded by this gene is required for hippocampal long-term potentiation (LTP) and spatial learning. In addition to its calcium-calmodulin (CaM)-dependent activity, this protein can undergo autophosphorylation, resulting in CaM-independent activity. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous targeted mutants display deficient long-term hippocampal potentiation (LTP) and specific impairment in spatial learning; heterozygotes show decreased fear response and increased defensive aggression, which is more pronounced in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,393,477 H80L possibly damaging Het
A1bg A T 15: 60,919,635 probably null Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Agrn T A 4: 156,172,299 Y1283F probably benign Het
Akap6 T C 12: 52,796,190 V107A probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Btnl9 A T 11: 49,180,747 V83E probably damaging Het
Ccdc14 C T 16: 34,723,828 T852M probably damaging Het
Cntn4 T C 6: 106,353,597 probably benign Het
Cp T G 3: 19,977,152 S585R probably damaging Het
Cpt1b G A 15: 89,419,010 A614V probably benign Het
Crygn T C 5: 24,751,148 Y153C probably damaging Het
Dennd1a A T 2: 37,961,716 D53E probably damaging Het
Deptor T C 15: 55,252,010 C357R probably benign Het
Dnajc28 C A 16: 91,618,642 probably benign Het
Eml6 G A 11: 29,755,044 A1500V possibly damaging Het
Fgd5 T A 6: 91,986,978 L64Q possibly damaging Het
Fgfbp1 A G 5: 43,979,597 Y118H probably damaging Het
Ftcd G A 10: 76,579,819 R135H probably damaging Het
Gm5174 A T 10: 86,657,325 noncoding transcript Het
Gpr37l1 A T 1: 135,166,972 L178Q probably damaging Het
Gtf2ird1 A G 5: 134,411,064 V104A possibly damaging Het
Irs1 T A 1: 82,289,626 S290C probably damaging Het
Kel C T 6: 41,688,591 V532I possibly damaging Het
Kif1c A G 11: 70,708,601 E442G possibly damaging Het
Klhdc10 T A 6: 30,449,494 V185D probably damaging Het
Lpp C T 16: 24,681,860 R141C probably damaging Het
Olfr1025-ps1 A G 2: 85,918,035 I37V probably benign Het
Olfr68 A T 7: 103,777,985 M120K probably damaging Het
Pcnx2 G T 8: 125,887,314 P466H possibly damaging Het
Pcsk1 A T 13: 75,096,413 probably benign Het
Pkd2l2 T C 18: 34,438,216 probably null Het
Pomt1 A G 2: 32,250,492 N454S probably benign Het
Samhd1 A T 2: 157,109,461 I452N probably damaging Het
Sez6 A G 11: 77,953,885 Q178R probably benign Het
Slc25a44 A G 3: 88,420,986 V66A probably damaging Het
Slc46a2 T C 4: 59,914,189 T245A probably benign Het
Slc4a4 G A 5: 89,215,794 probably null Het
Spata6 T A 4: 111,799,145 C329S possibly damaging Het
Srrm2 A T 17: 23,817,751 probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Svil T A 18: 5,059,217 probably benign Het
Tenm3 G T 8: 48,235,582 S2323R probably damaging Het
Tsc1 G A 2: 28,665,626 R245Q probably damaging Het
Ttn A G 2: 76,908,756 V3813A probably benign Het
Ttn G A 2: 76,950,044 T1121M possibly damaging Het
Ush2a G A 1: 188,759,795 V3094I probably benign Het
Vcan A G 13: 89,679,794 probably null Het
Vmn1r189 A T 13: 22,102,658 L3Q probably damaging Het
Vmn1r60 A C 7: 5,544,972 V43G probably damaging Het
Vmn2r110 A G 17: 20,583,263 I350T probably benign Het
Vmn2r86 T A 10: 130,448,574 probably benign Het
Xrn1 A G 9: 95,981,761 probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Camk2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Camk2a APN 18 60980156 critical splice donor site probably null
IGL01707:Camk2a APN 18 60960050 splice site probably null
IGL02117:Camk2a APN 18 60977989 missense probably damaging 0.99
frantic UTSW 18 60963928 nonsense probably null
R0003:Camk2a UTSW 18 60960007 missense probably damaging 0.99
R0373:Camk2a UTSW 18 60958238 missense probably damaging 0.98
R0589:Camk2a UTSW 18 60963964 critical splice donor site probably null
R1135:Camk2a UTSW 18 60957396 critical splice donor site probably null
R2159:Camk2a UTSW 18 60957185 missense probably damaging 1.00
R2291:Camk2a UTSW 18 60963959 missense probably damaging 1.00
R4022:Camk2a UTSW 18 60963928 nonsense probably null
R4662:Camk2a UTSW 18 60941339 missense probably damaging 1.00
R4664:Camk2a UTSW 18 60955624 missense possibly damaging 0.91
R4859:Camk2a UTSW 18 60943174 intron probably benign
R5119:Camk2a UTSW 18 60943136 intron probably benign
R5291:Camk2a UTSW 18 60957164 missense probably damaging 1.00
R5503:Camk2a UTSW 18 60978000 missense probably damaging 0.99
R5874:Camk2a UTSW 18 60943200 intron probably benign
R5997:Camk2a UTSW 18 60977957 missense probably damaging 1.00
R6109:Camk2a UTSW 18 60943234 nonsense probably null
R6772:Camk2a UTSW 18 60969020 missense probably benign 0.21
R6939:Camk2a UTSW 18 60958154 missense probably damaging 1.00
R6977:Camk2a UTSW 18 60960004 missense probably damaging 1.00
R6993:Camk2a UTSW 18 60943175 intron probably benign
R7247:Camk2a UTSW 18 60943205 missense unknown
R7625:Camk2a UTSW 18 60952340 missense probably damaging 0.97
X0020:Camk2a UTSW 18 60960037 missense possibly damaging 0.89
X0026:Camk2a UTSW 18 60952136 missense possibly damaging 0.87
Z1088:Camk2a UTSW 18 60943150 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATTACAGTGAAGCTGATGCCAGGTG -3'
(R):5'- GGTACAAACTGCATGGGGCTAGAC -3'

Sequencing Primer
(F):5'- TGAGTACTGGCTGCAACCTG -3'
(R):5'- GGTCTGTCTTGACAGCTAGAAAAC -3'
Posted On2014-01-15