Mutagenetix > Incidental Mutation

Incidental Mutation 'R1200:Clstn3'

101293

Institutional Source

Beutler Lab

Gene Symbol

Clstn3

Ensembl Gene

ENSMUSG00000008153

Gene Name

calsyntenin 3

Synonyms

Cst-3, CSTN3, alcadein-beta

MMRRC Submission

039270-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1200 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124407715-124441743 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 124436129 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 207 (P207T)

Ref Sequence

ENSEMBL: ENSMUSP00000108142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523] [ENSMUST00000150774]

AlphaFold

Q99JH7

Predicted Effect

probably damaging
Transcript: ENSMUST00000008297
AA Change: P244T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: P244T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
CA	50	143	2.72e-12	SMART
CA	166	244	4.04e-2	SMART
SCOP:d1a8d_1	333	549	7e-23	SMART
transmembrane domain	846	868	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112523
AA Change: P207T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: P207T

Domain	Start	End	E-Value	Type
CA	13	106	2.72e-12	SMART
CA	129	207	4.04e-2	SMART
Pfam:Laminin_G_3	304	505	4.1e-8	PFAM
transmembrane domain	809	831	N/A	INTRINSIC
low complexity region	891	908	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150774

SMART Domains

Protein: ENSMUSP00000145422
Gene: ENSMUSG00000008153

Domain	Start	End	E-Value	Type
Blast:CA	13	64	4e-31	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156040

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.6%
20x: 87.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	C	16: 4,667,536 (GRCm39)	F309S	unknown	Het
Abcc2	A	T	19: 43,822,426 (GRCm39)	Q1421H	probably damaging	Het
Acat1	T	A	9: 53,494,810 (GRCm39)	I361F	possibly damaging	Het
Akp3	T	A	1: 87,052,982 (GRCm39)	I57N	probably damaging	Het
Amph	G	A	13: 19,326,198 (GRCm39)	V643M	probably damaging	Het
Axin2	C	A	11: 108,822,376 (GRCm39)	D309E	probably damaging	Het
Dip2b	C	A	15: 100,107,626 (GRCm39)	A1212E	probably benign	Het
Dnah5	A	G	15: 28,246,403 (GRCm39)	I580M	possibly damaging	Het
Dpp3	T	C	19: 4,973,157 (GRCm39)	T146A	probably benign	Het
Fam227a	A	G	15: 79,496,738 (GRCm39)	F613S	possibly damaging	Het
Fam83b	T	C	9: 76,399,594 (GRCm39)	D503G	probably damaging	Het
Flot2	C	T	11: 77,945,631 (GRCm39)	T2M	probably damaging	Het
Herc1	T	C	9: 66,393,406 (GRCm39)	L4095S	probably damaging	Het
Kcnh7	T	C	2: 62,607,739 (GRCm39)	Y614C	probably damaging	Het
Lcp1	T	A	14: 75,466,742 (GRCm39)	F616L	possibly damaging	Het
Myh15	T	A	16: 48,916,882 (GRCm39)	Y401N	probably damaging	Het
Neb	T	C	2: 52,057,657 (GRCm39)	Y6144C	probably damaging	Het
Nr1h5	A	G	3: 102,855,178 (GRCm39)	F308L	probably damaging	Het
Ntn5	G	T	7: 45,341,806 (GRCm39)	V309L	possibly damaging	Het
Or51aa2	T	A	7: 103,188,274 (GRCm39)	T56S	probably benign	Het
Or8k21	A	T	2: 86,145,477 (GRCm39)	L51Q	probably damaging	Het
Pex1	G	A	5: 3,656,411 (GRCm39)		probably null	Het
Pld1	A	T	3: 28,103,435 (GRCm39)	D380V	probably damaging	Het
Prdm1	A	G	10: 44,326,126 (GRCm39)	Y148H	probably damaging	Het
Ptchd3	T	C	11: 121,722,087 (GRCm39)		probably null	Het
Rnf17	C	T	14: 56,705,163 (GRCm39)	T689I	probably benign	Het
Stard9	C	A	2: 120,504,117 (GRCm39)	S221R	probably damaging	Het
Twf1	A	T	15: 94,484,239 (GRCm39)	H94Q	probably benign	Het
Vmn2r13	T	G	5: 109,322,068 (GRCm39)	I210L	probably damaging	Het
Zbtb49	T	C	5: 38,370,675 (GRCm39)	E402G	probably damaging	Het

Other mutations in Clstn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Clstn3	APN	6	124,439,098 (GRCm39)	missense	probably damaging	1.00
IGL01415:Clstn3	APN	6	124,415,781 (GRCm39)	nonsense	probably null
IGL01521:Clstn3	APN	6	124,434,990 (GRCm39)	nonsense	probably null
IGL01537:Clstn3	APN	6	124,408,559 (GRCm39)	missense	possibly damaging	0.91
IGL01729:Clstn3	APN	6	124,426,753 (GRCm39)	missense	probably benign	0.06
IGL01879:Clstn3	APN	6	124,415,769 (GRCm39)	missense	probably damaging	1.00
IGL01998:Clstn3	APN	6	124,435,622 (GRCm39)	missense	probably damaging	1.00
IGL03130:Clstn3	APN	6	124,436,222 (GRCm39)	missense	probably damaging	0.98
IGL03405:Clstn3	APN	6	124,415,327 (GRCm39)	missense	possibly damaging	0.95
PIT4403001:Clstn3	UTSW	6	124,434,982 (GRCm39)	missense	probably damaging	1.00
R0049:Clstn3	UTSW	6	124,436,812 (GRCm39)	missense	possibly damaging	0.87
R0049:Clstn3	UTSW	6	124,436,812 (GRCm39)	missense	possibly damaging	0.87
R0208:Clstn3	UTSW	6	124,409,128 (GRCm39)	splice site	probably benign
R0276:Clstn3	UTSW	6	124,408,699 (GRCm39)	splice site	probably benign
R0440:Clstn3	UTSW	6	124,428,372 (GRCm39)	missense	probably damaging	1.00
R0612:Clstn3	UTSW	6	124,426,459 (GRCm39)	missense	probably damaging	0.98
R1224:Clstn3	UTSW	6	124,434,878 (GRCm39)	missense	probably benign
R1378:Clstn3	UTSW	6	124,415,378 (GRCm39)	missense	probably damaging	1.00
R1491:Clstn3	UTSW	6	124,414,449 (GRCm39)	missense	possibly damaging	0.51
R1495:Clstn3	UTSW	6	124,426,876 (GRCm39)	missense	probably benign	0.00
R1511:Clstn3	UTSW	6	124,439,128 (GRCm39)	missense	probably damaging	1.00
R1655:Clstn3	UTSW	6	124,414,386 (GRCm39)	missense	probably damaging	1.00
R1731:Clstn3	UTSW	6	124,408,591 (GRCm39)	missense	probably benign	0.04
R1734:Clstn3	UTSW	6	124,413,773 (GRCm39)	splice site	probably benign
R1751:Clstn3	UTSW	6	124,408,958 (GRCm39)	missense	probably damaging	1.00
R1954:Clstn3	UTSW	6	124,436,257 (GRCm39)	missense	possibly damaging	0.94
R2133:Clstn3	UTSW	6	124,426,462 (GRCm39)	missense	probably benign
R2192:Clstn3	UTSW	6	124,436,166 (GRCm39)	missense	probably damaging	1.00
R2314:Clstn3	UTSW	6	124,427,676 (GRCm39)	missense	probably benign	0.39
R2874:Clstn3	UTSW	6	124,415,294 (GRCm39)	missense	probably damaging	1.00
R3500:Clstn3	UTSW	6	124,408,670 (GRCm39)	missense	probably benign	0.01
R3761:Clstn3	UTSW	6	124,434,835 (GRCm39)	missense	possibly damaging	0.54
R3878:Clstn3	UTSW	6	124,434,901 (GRCm39)	missense	probably damaging	0.97
R3927:Clstn3	UTSW	6	124,428,327 (GRCm39)	missense	probably damaging	1.00
R3934:Clstn3	UTSW	6	124,434,901 (GRCm39)	missense	probably damaging	0.97
R3935:Clstn3	UTSW	6	124,434,901 (GRCm39)	missense	probably damaging	0.97
R4063:Clstn3	UTSW	6	124,426,792 (GRCm39)	missense	possibly damaging	0.51
R4402:Clstn3	UTSW	6	124,433,939 (GRCm39)	missense	probably damaging	0.96
R4534:Clstn3	UTSW	6	124,436,179 (GRCm39)	missense	probably damaging	1.00
R4785:Clstn3	UTSW	6	124,414,331 (GRCm39)	splice site	probably null
R4834:Clstn3	UTSW	6	124,408,912 (GRCm39)	splice site	probably null
R5921:Clstn3	UTSW	6	124,408,539 (GRCm39)	utr 3 prime	probably benign
R5932:Clstn3	UTSW	6	124,415,291 (GRCm39)	missense	probably benign	0.01
R6025:Clstn3	UTSW	6	124,408,623 (GRCm39)	missense	possibly damaging	0.73
R6101:Clstn3	UTSW	6	124,438,629 (GRCm39)	missense	probably damaging	1.00
R6360:Clstn3	UTSW	6	124,415,388 (GRCm39)	missense	possibly damaging	0.88
R6578:Clstn3	UTSW	6	124,427,663 (GRCm39)	critical splice donor site	probably null
R6813:Clstn3	UTSW	6	124,413,894 (GRCm39)	missense	probably benign	0.00
R7380:Clstn3	UTSW	6	124,433,948 (GRCm39)	missense	probably benign	0.01
R7419:Clstn3	UTSW	6	124,435,088 (GRCm39)	missense	probably benign	0.05
R7625:Clstn3	UTSW	6	124,414,377 (GRCm39)	nonsense	probably null
R7780:Clstn3	UTSW	6	124,439,161 (GRCm39)	missense	probably damaging	0.98
R7936:Clstn3	UTSW	6	124,408,972 (GRCm39)	missense	possibly damaging	0.73
R7939:Clstn3	UTSW	6	124,439,158 (GRCm39)	missense	probably damaging	1.00
R8047:Clstn3	UTSW	6	124,408,972 (GRCm39)	missense	possibly damaging	0.73
R8079:Clstn3	UTSW	6	124,436,763 (GRCm39)	missense	probably damaging	1.00
R8085:Clstn3	UTSW	6	124,435,683 (GRCm39)	missense	probably benign	0.23
R8299:Clstn3	UTSW	6	124,414,332 (GRCm39)	critical splice donor site	probably null
R8406:Clstn3	UTSW	6	124,439,136 (GRCm39)	missense	probably damaging	1.00
R8685:Clstn3	UTSW	6	124,433,867 (GRCm39)	missense	probably damaging	1.00
R9045:Clstn3	UTSW	6	124,408,921 (GRCm39)	missense	probably damaging	0.98
R9209:Clstn3	UTSW	6	124,408,571 (GRCm39)	missense	probably benign	0.02
R9264:Clstn3	UTSW	6	124,436,727 (GRCm39)	missense	probably damaging	1.00
R9268:Clstn3	UTSW	6	124,433,880 (GRCm39)	missense	probably damaging	0.99
R9443:Clstn3	UTSW	6	124,428,358 (GRCm39)	missense	probably damaging	1.00
RF014:Clstn3	UTSW	6	124,436,225 (GRCm39)	nonsense	probably null
X0066:Clstn3	UTSW	6	124,426,770 (GRCm39)	missense	probably benign	0.13
Z1176:Clstn3	UTSW	6	124,436,159 (GRCm39)	missense	probably damaging	1.00
Z1177:Clstn3	UTSW	6	124,426,740 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTTGTTCCAGCCTGCACAGGTGAG -3'
(R):5'- TTTTCCACCCCAGGCAACATTGAG -3'

Sequencing Primer
(F):5'- aataaataaaaatagggctggagagg -3'
(R):5'- CATTGAGAACACAGAGAAGCTAC -3'

Posted On

2014-01-15