Incidental Mutation 'R1200:Fam83b'
ID 101303
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Name family with sequence similarity 83, member B
Synonyms C530008M07Rik
MMRRC Submission 039270-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R1200 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 76397336-76474398 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76399594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 503 (D503G)
Ref Sequence ENSEMBL: ENSMUSP00000139354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
AlphaFold Q0VBM2
Predicted Effect probably damaging
Transcript: ENSMUST00000098546
AA Change: D503G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: D503G

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183437
AA Change: D503G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: D503G

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,536 (GRCm39) F309S unknown Het
Abcc2 A T 19: 43,822,426 (GRCm39) Q1421H probably damaging Het
Acat1 T A 9: 53,494,810 (GRCm39) I361F possibly damaging Het
Akp3 T A 1: 87,052,982 (GRCm39) I57N probably damaging Het
Amph G A 13: 19,326,198 (GRCm39) V643M probably damaging Het
Axin2 C A 11: 108,822,376 (GRCm39) D309E probably damaging Het
Clstn3 G T 6: 124,436,129 (GRCm39) P207T probably damaging Het
Dip2b C A 15: 100,107,626 (GRCm39) A1212E probably benign Het
Dnah5 A G 15: 28,246,403 (GRCm39) I580M possibly damaging Het
Dpp3 T C 19: 4,973,157 (GRCm39) T146A probably benign Het
Fam227a A G 15: 79,496,738 (GRCm39) F613S possibly damaging Het
Flot2 C T 11: 77,945,631 (GRCm39) T2M probably damaging Het
Herc1 T C 9: 66,393,406 (GRCm39) L4095S probably damaging Het
Kcnh7 T C 2: 62,607,739 (GRCm39) Y614C probably damaging Het
Lcp1 T A 14: 75,466,742 (GRCm39) F616L possibly damaging Het
Myh15 T A 16: 48,916,882 (GRCm39) Y401N probably damaging Het
Neb T C 2: 52,057,657 (GRCm39) Y6144C probably damaging Het
Nr1h5 A G 3: 102,855,178 (GRCm39) F308L probably damaging Het
Ntn5 G T 7: 45,341,806 (GRCm39) V309L possibly damaging Het
Or51aa2 T A 7: 103,188,274 (GRCm39) T56S probably benign Het
Or8k21 A T 2: 86,145,477 (GRCm39) L51Q probably damaging Het
Pex1 G A 5: 3,656,411 (GRCm39) probably null Het
Pld1 A T 3: 28,103,435 (GRCm39) D380V probably damaging Het
Prdm1 A G 10: 44,326,126 (GRCm39) Y148H probably damaging Het
Ptchd3 T C 11: 121,722,087 (GRCm39) probably null Het
Rnf17 C T 14: 56,705,163 (GRCm39) T689I probably benign Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Twf1 A T 15: 94,484,239 (GRCm39) H94Q probably benign Het
Vmn2r13 T G 5: 109,322,068 (GRCm39) I210L probably damaging Het
Zbtb49 T C 5: 38,370,675 (GRCm39) E402G probably damaging Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76,398,260 (GRCm39) missense probably benign 0.00
IGL01554:Fam83b APN 9 76,409,403 (GRCm39) missense probably benign 0.33
IGL01694:Fam83b APN 9 76,398,272 (GRCm39) missense probably benign 0.13
IGL02009:Fam83b APN 9 76,399,604 (GRCm39) missense probably damaging 1.00
IGL02531:Fam83b APN 9 76,399,282 (GRCm39) missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76,400,324 (GRCm39) missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76,398,434 (GRCm39) missense probably damaging 1.00
R0110:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76,400,210 (GRCm39) nonsense probably null
R0946:Fam83b UTSW 9 76,398,679 (GRCm39) missense probably damaging 0.96
R0961:Fam83b UTSW 9 76,398,577 (GRCm39) missense probably damaging 0.97
R1101:Fam83b UTSW 9 76,452,952 (GRCm39) missense possibly damaging 0.68
R1248:Fam83b UTSW 9 76,410,358 (GRCm39) missense probably benign 0.35
R1420:Fam83b UTSW 9 76,399,894 (GRCm39) missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76,399,859 (GRCm39) missense probably benign
R1939:Fam83b UTSW 9 76,400,362 (GRCm39) missense probably damaging 1.00
R1992:Fam83b UTSW 9 76,399,304 (GRCm39) missense probably benign
R2102:Fam83b UTSW 9 76,399,987 (GRCm39) missense probably damaging 0.96
R2134:Fam83b UTSW 9 76,398,298 (GRCm39) missense probably damaging 1.00
R2398:Fam83b UTSW 9 76,409,500 (GRCm39) missense probably damaging 1.00
R2878:Fam83b UTSW 9 76,398,092 (GRCm39) missense probably damaging 1.00
R4092:Fam83b UTSW 9 76,398,943 (GRCm39) missense probably benign 0.24
R4204:Fam83b UTSW 9 76,410,335 (GRCm39) missense probably benign 0.09
R4537:Fam83b UTSW 9 76,399,424 (GRCm39) missense probably benign 0.10
R4920:Fam83b UTSW 9 76,399,150 (GRCm39) missense probably benign
R5456:Fam83b UTSW 9 76,399,877 (GRCm39) missense probably benign
R5473:Fam83b UTSW 9 76,398,782 (GRCm39) missense probably damaging 1.00
R5488:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5489:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5876:Fam83b UTSW 9 76,399,132 (GRCm39) missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76,399,639 (GRCm39) missense probably damaging 1.00
R6374:Fam83b UTSW 9 76,400,189 (GRCm39) missense probably benign 0.31
R6468:Fam83b UTSW 9 76,409,413 (GRCm39) nonsense probably null
R6912:Fam83b UTSW 9 76,398,214 (GRCm39) missense probably damaging 0.99
R7022:Fam83b UTSW 9 76,409,394 (GRCm39) frame shift probably null
R7073:Fam83b UTSW 9 76,453,031 (GRCm39) missense probably benign 0.18
R7356:Fam83b UTSW 9 76,400,135 (GRCm39) missense probably benign 0.05
R7665:Fam83b UTSW 9 76,398,157 (GRCm39) missense probably damaging 1.00
R7762:Fam83b UTSW 9 76,399,714 (GRCm39) missense possibly damaging 0.87
R7790:Fam83b UTSW 9 76,399,330 (GRCm39) missense probably benign 0.01
R7869:Fam83b UTSW 9 76,399,426 (GRCm39) missense possibly damaging 0.78
R7879:Fam83b UTSW 9 76,399,737 (GRCm39) missense possibly damaging 0.76
R7957:Fam83b UTSW 9 76,399,267 (GRCm39) missense probably benign 0.00
R8067:Fam83b UTSW 9 76,398,380 (GRCm39) missense probably benign
R8983:Fam83b UTSW 9 76,400,357 (GRCm39) missense probably damaging 1.00
R9361:Fam83b UTSW 9 76,400,076 (GRCm39) missense probably benign 0.03
R9405:Fam83b UTSW 9 76,398,703 (GRCm39) missense possibly damaging 0.93
R9475:Fam83b UTSW 9 76,399,085 (GRCm39) missense probably benign 0.31
R9656:Fam83b UTSW 9 76,452,863 (GRCm39) missense probably benign 0.02
R9690:Fam83b UTSW 9 76,398,502 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGCTTCCTTGAGAACCGATGATG -3'
(R):5'- ACCAATAATGCTCCTGGACGCTG -3'

Sequencing Primer
(F):5'- AACCGATGATGGTGGAATTTG -3'
(R):5'- GCCTTCAGACAGTCTCAGTGTAG -3'
Posted On 2014-01-15