Incidental Mutation 'R1200:Dip2b'
ID 101329
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 039270-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.596) question?
Stock # R1200 (G1)
Quality Score 185
Status Not validated
Chromosome 15
Chromosomal Location 100038664-100219473 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100209745 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 1212 (A1212E)
Ref Sequence ENSEMBL: ENSMUSP00000023768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably benign
Transcript: ENSMUST00000023768
AA Change: A1212E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: A1212E

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
AA Change: A1446E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: A1446E

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108971
AA Change: A1212E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: A1212E

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135658
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 (GRCm38) F309S unknown Het
Abcc2 A T 19: 43,833,987 (GRCm38) Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 (GRCm38) I361F possibly damaging Het
Akp3 T A 1: 87,125,260 (GRCm38) I57N probably damaging Het
Amph G A 13: 19,142,028 (GRCm38) V643M probably damaging Het
Axin2 C A 11: 108,931,550 (GRCm38) D309E probably damaging Het
Clstn3 G T 6: 124,459,170 (GRCm38) P207T probably damaging Het
Dnah5 A G 15: 28,246,257 (GRCm38) I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 (GRCm38) T146A probably benign Het
Fam227a A G 15: 79,612,537 (GRCm38) F613S possibly damaging Het
Fam83b T C 9: 76,492,312 (GRCm38) D503G probably damaging Het
Flot2 C T 11: 78,054,805 (GRCm38) T2M probably damaging Het
Herc1 T C 9: 66,486,124 (GRCm38) L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 (GRCm38) Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 (GRCm38) F616L possibly damaging Het
Myh15 T A 16: 49,096,519 (GRCm38) Y401N probably damaging Het
Neb T C 2: 52,167,645 (GRCm38) Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 (GRCm38) F308L probably damaging Het
Ntn5 G T 7: 45,692,382 (GRCm38) V309L possibly damaging Het
Or51aa2 T A 7: 103,539,067 (GRCm38) T56S probably benign Het
Or8k21 A T 2: 86,315,133 (GRCm38) L51Q probably damaging Het
Pex1 G A 5: 3,606,411 (GRCm38) probably null Het
Pld1 A T 3: 28,049,286 (GRCm38) D380V probably damaging Het
Prdm1 A G 10: 44,450,130 (GRCm38) Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 (GRCm38) probably null Het
Rnf17 C T 14: 56,467,706 (GRCm38) T689I probably benign Het
Stard9 C A 2: 120,673,636 (GRCm38) S221R probably damaging Het
Twf1 A T 15: 94,586,358 (GRCm38) H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 (GRCm38) I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 (GRCm38) E402G probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,174,501 (GRCm38) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,209,636 (GRCm38) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,171,220 (GRCm38) splice site probably benign
IGL01915:Dip2b APN 15 100,178,511 (GRCm38) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,186,250 (GRCm38) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,151,202 (GRCm38) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,157,281 (GRCm38) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,157,885 (GRCm38) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,215,311 (GRCm38) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,132,022 (GRCm38) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,203,127 (GRCm38) splice site probably benign
IGL03181:Dip2b APN 15 100,215,207 (GRCm38) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,207,838 (GRCm38) splice site probably benign
IGL03399:Dip2b APN 15 100,175,327 (GRCm38) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,202,352 (GRCm38) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,169,312 (GRCm38) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,215,240 (GRCm38) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,215,240 (GRCm38) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,202,265 (GRCm38) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,186,147 (GRCm38) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,211,993 (GRCm38) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,193,913 (GRCm38) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,162,719 (GRCm38) nonsense probably null
R0730:Dip2b UTSW 15 100,171,651 (GRCm38) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,154,250 (GRCm38) missense probably benign 0.11
R1506:Dip2b UTSW 15 100,183,113 (GRCm38) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,178,466 (GRCm38) missense probably benign
R1760:Dip2b UTSW 15 100,212,029 (GRCm38) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,193,961 (GRCm38) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,198,938 (GRCm38) splice site probably null
R2264:Dip2b UTSW 15 100,203,216 (GRCm38) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,142,137 (GRCm38) nonsense probably null
R4029:Dip2b UTSW 15 100,186,172 (GRCm38) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,186,172 (GRCm38) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,181,336 (GRCm38) missense probably benign
R4392:Dip2b UTSW 15 100,162,036 (GRCm38) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,186,301 (GRCm38) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,157,258 (GRCm38) nonsense probably null
R4605:Dip2b UTSW 15 100,209,636 (GRCm38) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,215,329 (GRCm38) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,160,491 (GRCm38) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,151,360 (GRCm38) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,207,777 (GRCm38) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,169,281 (GRCm38) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,195,784 (GRCm38) splice site probably null
R4877:Dip2b UTSW 15 100,160,529 (GRCm38) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,171,722 (GRCm38) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,195,784 (GRCm38) splice site probably null
R5169:Dip2b UTSW 15 100,205,113 (GRCm38) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,211,986 (GRCm38) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,154,296 (GRCm38) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,212,104 (GRCm38) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,211,986 (GRCm38) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,205,173 (GRCm38) intron probably benign
R5447:Dip2b UTSW 15 100,211,986 (GRCm38) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,190,104 (GRCm38) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,157,945 (GRCm38) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,151,184 (GRCm38) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,209,694 (GRCm38) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,190,079 (GRCm38) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,162,702 (GRCm38) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,154,282 (GRCm38) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,115,914 (GRCm38) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,151,276 (GRCm38) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,199,011 (GRCm38) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,193,954 (GRCm38) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,193,843 (GRCm38) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,160,465 (GRCm38) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,157,972 (GRCm38) splice site probably null
R7176:Dip2b UTSW 15 100,169,318 (GRCm38) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,209,627 (GRCm38) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,154,157 (GRCm38) missense probably benign
R7513:Dip2b UTSW 15 100,207,748 (GRCm38) splice site probably null
R7876:Dip2b UTSW 15 100,191,041 (GRCm38) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,154,243 (GRCm38) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,173,271 (GRCm38) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,195,876 (GRCm38) missense probably benign 0.05
R9477:Dip2b UTSW 15 100,038,903 (GRCm38) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,155,043 (GRCm38) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,175,297 (GRCm38) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,181,374 (GRCm38) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,209,580 (GRCm38) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,115,850 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTCACAACTGATGGAGAGCAAG -3'
(R):5'- GTCCTATGATACTCGGGGCAGTTTG -3'

Sequencing Primer
(F):5'- tcagaaatccgcctgcc -3'
(R):5'- AAGGGGTTCTCTTCCAGATAGTC -3'
Posted On 2014-01-15