Incidental Mutation 'R1201:Actc1'
ID101346
Institutional Source Beutler Lab
Gene Symbol Actc1
Ensembl Gene ENSMUSG00000068614
Gene Nameactin, alpha, cardiac muscle 1
Synonymsalphac-actin, Actc-1
MMRRC Submission 039271-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1201 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location114047282-114053548 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 114049513 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090269] [ENSMUST00000149125]
Predicted Effect probably null
Transcript: ENSMUST00000090269
SMART Domains Protein: ENSMUSP00000087736
Gene: ENSMUSG00000068614

DomainStartEndE-ValueType
ACTIN 7 377 4.38e-238 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140041
Predicted Effect probably benign
Transcript: ENSMUST00000149125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154140
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Actins are highly conserved proteins that are involved in various types of cell motility. Polymerization of globular actin (G-actin) leads to a structural filament (F-actin) in the form of a two-stranded helix. Each actin can bind to four others. The protein encoded by this gene belongs to the actin family which is comprised of three main groups of actin isoforms, alpha, beta, and gamma. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. Defects in this gene have been associated with idiopathic dilated cardiomyopathy (IDC) and familial hypertrophic cardiomyopathy (FHC). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation of this gene results in embryonic and postnatal lethality. Animals that survive to birth die within the first 2 weeks and display reduced body size and heart muscle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,716,282 T103A possibly damaging Het
4932438A13Rik A G 3: 36,948,375 S1490G probably benign Het
Acly A G 11: 100,493,935 I674T probably damaging Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Arhgap40 A C 2: 158,534,769 D275A probably damaging Het
Car11 A G 7: 45,703,480 D221G probably benign Het
Catsperg1 A T 7: 29,191,670 H596Q possibly damaging Het
Ccm2 T C 11: 6,593,682 V231A probably benign Het
Crh A G 3: 19,693,926 I184T probably damaging Het
Csgalnact2 A G 6: 118,114,432 S424P probably damaging Het
Dbf4 A C 5: 8,397,498 L571V possibly damaging Het
Fam105a G A 15: 27,658,173 Q84* probably null Het
Fancm A G 12: 65,106,768 K66E possibly damaging Het
Hydin T C 8: 110,569,855 V3672A probably benign Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Krt36 T C 11: 100,104,057 N230D probably benign Het
Nlrp4b G T 7: 10,715,436 R522L possibly damaging Het
Ntn1 T C 11: 68,213,226 D532G probably damaging Het
Numb A T 12: 83,801,285 V215D probably damaging Het
Olfr1355 A T 10: 78,879,477 M102L probably benign Het
Olfr1415 T G 1: 92,491,153 I201L probably benign Het
Olfr175-ps1 A G 16: 58,823,863 I282T probably damaging Het
Olfr54 T A 11: 51,027,110 M36K probably damaging Het
Olfr727 T A 14: 50,127,356 W260R probably damaging Het
Pidd1 A G 7: 141,440,274 F580L probably benign Het
Plekhg4 A G 8: 105,381,673 D1116G probably damaging Het
Prss33 G T 17: 23,835,110 S74* probably null Het
Rab34 T A 11: 78,190,396 probably null Het
Rims2 A C 15: 39,616,324 T1251P possibly damaging Het
Skint5 A G 4: 113,556,145 S1152P unknown Het
Slc6a17 T A 3: 107,493,072 Q206L possibly damaging Het
Tmem59l C T 8: 70,484,387 W310* probably null Het
Tnrc6c T G 11: 117,721,674 N379K probably damaging Het
Vmn1r76 A C 7: 11,930,325 F286V probably benign Het
Xdh T C 17: 73,918,418 D463G probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Zfp263 T A 16: 3,749,430 H536Q probably damaging Het
Zfp607a T A 7: 27,879,311 F602Y probably damaging Het
Other mutations in Actc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Actc1 APN 2 114048113 unclassified probably benign
IGL02985:Actc1 APN 2 114048160 missense probably damaging 1.00
IGL03204:Actc1 APN 2 114049530 missense possibly damaging 0.57
R1463:Actc1 UTSW 2 114049529 missense probably damaging 1.00
R4255:Actc1 UTSW 2 114049216 missense probably benign 0.02
R4476:Actc1 UTSW 2 114049226 missense probably benign
R4581:Actc1 UTSW 2 114049608 missense possibly damaging 0.88
R5466:Actc1 UTSW 2 114050498 missense probably damaging 0.99
R6395:Actc1 UTSW 2 114049250 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATCCAGGGCGACGTAACACAG -3'
(R):5'- TGGCTGAAGCAGTGGTTCGAAG -3'

Sequencing Primer
(F):5'- GGCGACGTAACACAGTTTTTC -3'
(R):5'- TCCCATCTATGAGGGTTATGCC -3'
Posted On2014-01-15