Incidental Mutation 'R1201:Arhgap40'
ID101348
Institutional Source Beutler Lab
Gene Symbol Arhgap40
Ensembl Gene ENSMUSG00000074625
Gene NameRho GTPase activating protein 40
SynonymsGm14203
MMRRC Submission 039271-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.522) question?
Stock #R1201 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location158512796-158550762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 158534769 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 275 (D275A)
Ref Sequence ENSEMBL: ENSMUSP00000130349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099133] [ENSMUST00000165398]
Predicted Effect probably damaging
Transcript: ENSMUST00000099133
AA Change: D278A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096736
Gene: ENSMUSG00000074625
AA Change: D278A

DomainStartEndE-ValueType
low complexity region 123 143 N/A INTRINSIC
RhoGAP 340 519 1.84e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165398
AA Change: D275A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130349
Gene: ENSMUSG00000074625
AA Change: D275A

DomainStartEndE-ValueType
low complexity region 120 140 N/A INTRINSIC
RhoGAP 337 516 1.84e-47 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,716,282 T103A possibly damaging Het
4932438A13Rik A G 3: 36,948,375 S1490G probably benign Het
Acly A G 11: 100,493,935 I674T probably damaging Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Actc1 A G 2: 114,049,513 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Car11 A G 7: 45,703,480 D221G probably benign Het
Catsperg1 A T 7: 29,191,670 H596Q possibly damaging Het
Ccm2 T C 11: 6,593,682 V231A probably benign Het
Crh A G 3: 19,693,926 I184T probably damaging Het
Csgalnact2 A G 6: 118,114,432 S424P probably damaging Het
Dbf4 A C 5: 8,397,498 L571V possibly damaging Het
Fam105a G A 15: 27,658,173 Q84* probably null Het
Fancm A G 12: 65,106,768 K66E possibly damaging Het
Hydin T C 8: 110,569,855 V3672A probably benign Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Krt36 T C 11: 100,104,057 N230D probably benign Het
Nlrp4b G T 7: 10,715,436 R522L possibly damaging Het
Ntn1 T C 11: 68,213,226 D532G probably damaging Het
Numb A T 12: 83,801,285 V215D probably damaging Het
Olfr1355 A T 10: 78,879,477 M102L probably benign Het
Olfr1415 T G 1: 92,491,153 I201L probably benign Het
Olfr175-ps1 A G 16: 58,823,863 I282T probably damaging Het
Olfr54 T A 11: 51,027,110 M36K probably damaging Het
Olfr727 T A 14: 50,127,356 W260R probably damaging Het
Pidd1 A G 7: 141,440,274 F580L probably benign Het
Plekhg4 A G 8: 105,381,673 D1116G probably damaging Het
Prss33 G T 17: 23,835,110 S74* probably null Het
Rab34 T A 11: 78,190,396 probably null Het
Rims2 A C 15: 39,616,324 T1251P possibly damaging Het
Skint5 A G 4: 113,556,145 S1152P unknown Het
Slc6a17 T A 3: 107,493,072 Q206L possibly damaging Het
Tmem59l C T 8: 70,484,387 W310* probably null Het
Tnrc6c T G 11: 117,721,674 N379K probably damaging Het
Vmn1r76 A C 7: 11,930,325 F286V probably benign Het
Xdh T C 17: 73,918,418 D463G probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Zfp263 T A 16: 3,749,430 H536Q probably damaging Het
Zfp607a T A 7: 27,879,311 F602Y probably damaging Het
Other mutations in Arhgap40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Arhgap40 APN 2 158531158 missense probably benign 0.41
IGL00547:Arhgap40 APN 2 158538626 splice site probably benign
IGL00911:Arhgap40 APN 2 158534716 splice site probably benign
IGL01084:Arhgap40 APN 2 158543218 missense probably damaging 1.00
IGL02037:Arhgap40 APN 2 158534822 missense probably damaging 1.00
IGL02111:Arhgap40 APN 2 158539844 missense probably damaging 0.99
IGL02131:Arhgap40 APN 2 158531939 splice site probably null
IGL02552:Arhgap40 APN 2 158546801 missense probably benign
PIT4305001:Arhgap40 UTSW 2 158531905 missense probably benign 0.00
R0212:Arhgap40 UTSW 2 158550575 missense probably damaging 1.00
R0508:Arhgap40 UTSW 2 158546750 missense probably damaging 1.00
R0787:Arhgap40 UTSW 2 158547790 missense probably benign
R1075:Arhgap40 UTSW 2 158549647 missense possibly damaging 0.54
R1511:Arhgap40 UTSW 2 158527161 missense probably benign
R1519:Arhgap40 UTSW 2 158546801 missense probably benign
R1567:Arhgap40 UTSW 2 158546799 missense probably damaging 1.00
R1662:Arhgap40 UTSW 2 158539270 missense probably damaging 1.00
R4120:Arhgap40 UTSW 2 158532330 missense probably benign 0.02
R4592:Arhgap40 UTSW 2 158546709 missense possibly damaging 0.88
R4678:Arhgap40 UTSW 2 158532306 missense probably benign 0.01
R4818:Arhgap40 UTSW 2 158539719 missense probably damaging 1.00
R4953:Arhgap40 UTSW 2 158543406 missense possibly damaging 0.57
R5108:Arhgap40 UTSW 2 158547679 missense probably damaging 1.00
R5578:Arhgap40 UTSW 2 158531206 missense probably damaging 0.99
R6924:Arhgap40 UTSW 2 158527146 missense probably benign 0.00
R6931:Arhgap40 UTSW 2 158531218 missense probably benign 0.00
R7028:Arhgap40 UTSW 2 158531374 critical splice donor site probably null
R7253:Arhgap40 UTSW 2 158547656 missense probably benign
R7385:Arhgap40 UTSW 2 158543227 missense probably damaging 1.00
R7670:Arhgap40 UTSW 2 158531925 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCACAATGCTGAAAGCTGCCTG -3'
(R):5'- AGTGAACGCTGCTTGTATCTGCC -3'

Sequencing Primer
(F):5'- TCTCTACCAGGCTCATAGGCAG -3'
(R):5'- AGGCAACCCGAGTTCTCAG -3'
Posted On2014-01-15