Incidental Mutation 'R1201:Slc6a17'
ID 101356
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms NTT4, D130012J15Rik
MMRRC Submission 039271-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R1201 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 107374864-107425334 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107400388 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 206 (Q206L)
Ref Sequence ENSEMBL: ENSMUSP00000131888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000166892] [ENSMUST00000168211] [ENSMUST00000169449]
AlphaFold Q8BJI1
Predicted Effect possibly damaging
Transcript: ENSMUST00000029499
AA Change: Q247L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: Q247L

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166892
SMART Domains Protein: ENSMUSP00000129588
Gene: ENSMUSG00000027894

DomainStartEndE-ValueType
Pfam:SNF 60 116 1.1e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167975
Predicted Effect possibly damaging
Transcript: ENSMUST00000168211
AA Change: Q206L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: Q206L

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169413
Predicted Effect possibly damaging
Transcript: ENSMUST00000169449
AA Change: Q247L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: Q247L

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170429
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,546,626 (GRCm39) T103A possibly damaging Het
Acly A G 11: 100,384,761 (GRCm39) I674T probably damaging Het
Aco2 C T 15: 81,779,394 (GRCm39) S33L probably damaging Het
Actc1 A G 2: 113,879,994 (GRCm39) probably null Het
Amph G A 13: 19,326,198 (GRCm39) V643M probably damaging Het
Arhgap40 A C 2: 158,376,689 (GRCm39) D275A probably damaging Het
Bltp1 A G 3: 37,002,524 (GRCm39) S1490G probably benign Het
Car11 A G 7: 45,352,904 (GRCm39) D221G probably benign Het
Catsperg1 A T 7: 28,891,095 (GRCm39) H596Q possibly damaging Het
Ccm2 T C 11: 6,543,682 (GRCm39) V231A probably benign Het
Crh A G 3: 19,748,090 (GRCm39) I184T probably damaging Het
Csgalnact2 A G 6: 118,091,393 (GRCm39) S424P probably damaging Het
Dbf4 A C 5: 8,447,498 (GRCm39) L571V possibly damaging Het
Fancm A G 12: 65,153,542 (GRCm39) K66E possibly damaging Het
Hydin T C 8: 111,296,487 (GRCm39) V3672A probably benign Het
Kcnh2 C T 5: 24,527,670 (GRCm39) R894H probably damaging Het
Krt36 T C 11: 99,994,883 (GRCm39) N230D probably benign Het
Nlrp4b G T 7: 10,449,363 (GRCm39) R522L possibly damaging Het
Ntn1 T C 11: 68,104,052 (GRCm39) D532G probably damaging Het
Numb A T 12: 83,848,059 (GRCm39) V215D probably damaging Het
Or1x2 T A 11: 50,917,937 (GRCm39) M36K probably damaging Het
Or4k15 T A 14: 50,364,813 (GRCm39) W260R probably damaging Het
Or5k8 A G 16: 58,644,226 (GRCm39) I282T probably damaging Het
Or6b2b T G 1: 92,418,875 (GRCm39) I201L probably benign Het
Or7a39 A T 10: 78,715,311 (GRCm39) M102L probably benign Het
Otulinl G A 15: 27,658,259 (GRCm39) Q84* probably null Het
Pidd1 A G 7: 141,020,187 (GRCm39) F580L probably benign Het
Plekhg4 A G 8: 106,108,305 (GRCm39) D1116G probably damaging Het
Prss33 G T 17: 24,054,084 (GRCm39) S74* probably null Het
Rab34 T A 11: 78,081,222 (GRCm39) probably null Het
Rims2 A C 15: 39,479,720 (GRCm39) T1251P possibly damaging Het
Skint5 A G 4: 113,413,342 (GRCm39) S1152P unknown Het
Tmem59l C T 8: 70,937,037 (GRCm39) W310* probably null Het
Tnrc6c T G 11: 117,612,500 (GRCm39) N379K probably damaging Het
Vmn1r76 A C 7: 11,664,252 (GRCm39) F286V probably benign Het
Xdh T C 17: 74,225,413 (GRCm39) D463G probably benign Het
Zfp251 C T 15: 76,738,436 (GRCm39) R219Q possibly damaging Het
Zfp263 T A 16: 3,567,294 (GRCm39) H536Q probably damaging Het
Zfp607a T A 7: 27,578,736 (GRCm39) F602Y probably damaging Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107,400,493 (GRCm39) missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107,402,993 (GRCm39) missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107,384,622 (GRCm39) missense probably damaging 1.00
BB002:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
BB012:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107,384,183 (GRCm39) missense probably benign 0.12
R1551:Slc6a17 UTSW 3 107,379,443 (GRCm39) missense possibly damaging 0.85
R1681:Slc6a17 UTSW 3 107,381,702 (GRCm39) missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107,380,895 (GRCm39) missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107,398,817 (GRCm39) nonsense probably null
R3708:Slc6a17 UTSW 3 107,400,401 (GRCm39) missense probably benign
R3814:Slc6a17 UTSW 3 107,378,633 (GRCm39) missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107,381,597 (GRCm39) missense probably benign
R4807:Slc6a17 UTSW 3 107,407,803 (GRCm39) missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107,378,753 (GRCm39) nonsense probably null
R6076:Slc6a17 UTSW 3 107,379,387 (GRCm39) missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107,407,722 (GRCm39) missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107,378,703 (GRCm39) missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107,378,755 (GRCm39) missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107,400,464 (GRCm39) missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107,398,794 (GRCm39) missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107,378,668 (GRCm39) missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107,381,671 (GRCm39) missense probably damaging 1.00
R7841:Slc6a17 UTSW 3 107,384,214 (GRCm39) missense possibly damaging 0.69
R7925:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R8041:Slc6a17 UTSW 3 107,381,744 (GRCm39) missense probably damaging 1.00
R8305:Slc6a17 UTSW 3 107,380,901 (GRCm39) missense probably benign 0.31
R8306:Slc6a17 UTSW 3 107,380,985 (GRCm39) missense probably benign
R8488:Slc6a17 UTSW 3 107,384,574 (GRCm39) missense possibly damaging 0.84
R8930:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R8932:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R9287:Slc6a17 UTSW 3 107,384,551 (GRCm39) missense probably damaging 1.00
R9483:Slc6a17 UTSW 3 107,378,772 (GRCm39) missense possibly damaging 0.50
R9601:Slc6a17 UTSW 3 107,380,930 (GRCm39) missense possibly damaging 0.95
R9617:Slc6a17 UTSW 3 107,384,685 (GRCm39) missense probably damaging 1.00
X0010:Slc6a17 UTSW 3 107,400,422 (GRCm39) missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107,407,684 (GRCm39) missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107,384,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTCCAGCAATGACTCCCCAGTAAG -3'
(R):5'- TGAGGATCTACCAGCTCATGGCAC -3'

Sequencing Primer
(F):5'- TAAGCTCACCCTTGGGCTG -3'
(R):5'- ACTGCAATCTGGGCAAGGTC -3'
Posted On 2014-01-15