Incidental Mutation 'R1201:Ccm2'
ID101395
Institutional Source Beutler Lab
Gene Symbol Ccm2
Ensembl Gene ENSMUSG00000000378
Gene Namecerebral cavernous malformation 2
Synonyms
MMRRC Submission 039271-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1201 (G1)
Quality Score119
Status Not validated
Chromosome11
Chromosomal Location6546887-6596744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6593682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 231 (V231A)
Ref Sequence ENSEMBL: ENSMUSP00000105344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000388] [ENSMUST00000045713] [ENSMUST00000109721] [ENSMUST00000109722] [ENSMUST00000159007] [ENSMUST00000160633] [ENSMUST00000161501]
Predicted Effect probably benign
Transcript: ENSMUST00000000388
AA Change: V295A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000388
Gene: ENSMUSG00000000378
AA Change: V295A

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Blast:PTB 60 230 2e-35 BLAST
low complexity region 242 252 N/A INTRINSIC
Pfam:CCM2_C 296 396 8.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045713
SMART Domains Protein: ENSMUSP00000049490
Gene: ENSMUSG00000041073

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
low complexity region 391 422 N/A INTRINSIC
low complexity region 454 479 N/A INTRINSIC
internal_repeat_1 537 689 6.19e-8 PROSPERO
low complexity region 692 713 N/A INTRINSIC
internal_repeat_1 732 889 6.19e-8 PROSPERO
low complexity region 924 939 N/A INTRINSIC
low complexity region 1159 1170 N/A INTRINSIC
low complexity region 1308 1325 N/A INTRINSIC
Pfam:NAC 1357 1413 2.9e-24 PFAM
low complexity region 1449 1466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109721
AA Change: V231A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105343
Gene: ENSMUSG00000000378
AA Change: V231A

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109722
AA Change: V231A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105344
Gene: ENSMUSG00000000378
AA Change: V231A

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000159007
SMART Domains Protein: ENSMUSP00000125608
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Blast:PTB 11 102 3e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160633
SMART Domains Protein: ENSMUSP00000125072
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 54 224 6e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161501
SMART Domains Protein: ENSMUSP00000123790
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 40 122 3e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161667
Predicted Effect probably benign
Transcript: ENSMUST00000177050
Predicted Effect probably benign
Transcript: ENSMUST00000177391
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions in the stress-activated p38 Mitogen-activated protein kinase (MAPK) signaling cascade. The protein interacts with SMAD specific E3 ubiquitin protein ligase 1 (also known as SMURF1) via a phosphotyrosine binding domain to promote RhoA degradation. The protein is required for normal cytoskeletal structure, cell-cell interactions, and lumen formation in endothelial cells. Mutations in this gene result in cerebral cavernous malformations. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice die during embryonic development with vasculature defects in the heart and placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,716,282 T103A possibly damaging Het
4932438A13Rik A G 3: 36,948,375 S1490G probably benign Het
Acly A G 11: 100,493,935 I674T probably damaging Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Actc1 A G 2: 114,049,513 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Arhgap40 A C 2: 158,534,769 D275A probably damaging Het
Car11 A G 7: 45,703,480 D221G probably benign Het
Catsperg1 A T 7: 29,191,670 H596Q possibly damaging Het
Crh A G 3: 19,693,926 I184T probably damaging Het
Csgalnact2 A G 6: 118,114,432 S424P probably damaging Het
Dbf4 A C 5: 8,397,498 L571V possibly damaging Het
Fam105a G A 15: 27,658,173 Q84* probably null Het
Fancm A G 12: 65,106,768 K66E possibly damaging Het
Hydin T C 8: 110,569,855 V3672A probably benign Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Krt36 T C 11: 100,104,057 N230D probably benign Het
Nlrp4b G T 7: 10,715,436 R522L possibly damaging Het
Ntn1 T C 11: 68,213,226 D532G probably damaging Het
Numb A T 12: 83,801,285 V215D probably damaging Het
Olfr1355 A T 10: 78,879,477 M102L probably benign Het
Olfr1415 T G 1: 92,491,153 I201L probably benign Het
Olfr175-ps1 A G 16: 58,823,863 I282T probably damaging Het
Olfr54 T A 11: 51,027,110 M36K probably damaging Het
Olfr727 T A 14: 50,127,356 W260R probably damaging Het
Pidd1 A G 7: 141,440,274 F580L probably benign Het
Plekhg4 A G 8: 105,381,673 D1116G probably damaging Het
Prss33 G T 17: 23,835,110 S74* probably null Het
Rab34 T A 11: 78,190,396 probably null Het
Rims2 A C 15: 39,616,324 T1251P possibly damaging Het
Skint5 A G 4: 113,556,145 S1152P unknown Het
Slc6a17 T A 3: 107,493,072 Q206L possibly damaging Het
Tmem59l C T 8: 70,484,387 W310* probably null Het
Tnrc6c T G 11: 117,721,674 N379K probably damaging Het
Vmn1r76 A C 7: 11,930,325 F286V probably benign Het
Xdh T C 17: 73,918,418 D463G probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Zfp263 T A 16: 3,749,430 H536Q probably damaging Het
Zfp607a T A 7: 27,879,311 F602Y probably damaging Het
Other mutations in Ccm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02126:Ccm2 APN 11 6594154 missense probably damaging 0.97
IGL02274:Ccm2 APN 11 6590808 missense probably damaging 1.00
IGL02946:Ccm2 APN 11 6596195 missense probably damaging 1.00
IGL02973:Ccm2 APN 11 6584544 missense probably damaging 1.00
R0521:Ccm2 UTSW 11 6590886 missense probably damaging 1.00
R1024:Ccm2 UTSW 11 6570119 nonsense probably null
R1687:Ccm2 UTSW 11 6585118 missense probably damaging 1.00
R2199:Ccm2 UTSW 11 6590790 missense probably damaging 1.00
R3237:Ccm2 UTSW 11 6570090 missense probably benign 0.43
R5196:Ccm2 UTSW 11 6561181 utr 5 prime probably benign
R6954:Ccm2 UTSW 11 6594239 missense probably damaging 0.98
R7195:Ccm2 UTSW 11 6596302 missense probably damaging 1.00
R7417:Ccm2 UTSW 11 6593091 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCAGTCCTCCTTAGTCGGTGTTC -3'
(R):5'- TTCAAACAGAGGCATCAGGCCCAG -3'

Sequencing Primer
(F):5'- CTTAGTCGGTGTTCGTGCTTG -3'
(R):5'- GCTGTTTCGAATCAGTACCAG -3'
Posted On2014-01-15