Incidental Mutation 'R1201:Krt36'
ID101403
Institutional Source Beutler Lab
Gene Symbol Krt36
Ensembl Gene ENSMUSG00000020916
Gene Namekeratin 36
SynonymsKrt1-22, keratin 5, HRa-1, Krt1-5
MMRRC Submission 039271-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1201 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100102007-100105626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100104057 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 230 (N230D)
Ref Sequence ENSEMBL: ENSMUSP00000103039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107416]
Predicted Effect probably benign
Transcript: ENSMUST00000107416
AA Change: N230D

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103039
Gene: ENSMUSG00000020916
AA Change: N230D

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Filament 92 403 4.05e-163 SMART
low complexity region 425 443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127883
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperkeratosis affecting the scales of the tail skin and the filiform papillae of the tongue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,716,282 T103A possibly damaging Het
4932438A13Rik A G 3: 36,948,375 S1490G probably benign Het
Acly A G 11: 100,493,935 I674T probably damaging Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Actc1 A G 2: 114,049,513 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Arhgap40 A C 2: 158,534,769 D275A probably damaging Het
Car11 A G 7: 45,703,480 D221G probably benign Het
Catsperg1 A T 7: 29,191,670 H596Q possibly damaging Het
Ccm2 T C 11: 6,593,682 V231A probably benign Het
Crh A G 3: 19,693,926 I184T probably damaging Het
Csgalnact2 A G 6: 118,114,432 S424P probably damaging Het
Dbf4 A C 5: 8,397,498 L571V possibly damaging Het
Fam105a G A 15: 27,658,173 Q84* probably null Het
Fancm A G 12: 65,106,768 K66E possibly damaging Het
Hydin T C 8: 110,569,855 V3672A probably benign Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Nlrp4b G T 7: 10,715,436 R522L possibly damaging Het
Ntn1 T C 11: 68,213,226 D532G probably damaging Het
Numb A T 12: 83,801,285 V215D probably damaging Het
Olfr1355 A T 10: 78,879,477 M102L probably benign Het
Olfr1415 T G 1: 92,491,153 I201L probably benign Het
Olfr175-ps1 A G 16: 58,823,863 I282T probably damaging Het
Olfr54 T A 11: 51,027,110 M36K probably damaging Het
Olfr727 T A 14: 50,127,356 W260R probably damaging Het
Pidd1 A G 7: 141,440,274 F580L probably benign Het
Plekhg4 A G 8: 105,381,673 D1116G probably damaging Het
Prss33 G T 17: 23,835,110 S74* probably null Het
Rab34 T A 11: 78,190,396 probably null Het
Rims2 A C 15: 39,616,324 T1251P possibly damaging Het
Skint5 A G 4: 113,556,145 S1152P unknown Het
Slc6a17 T A 3: 107,493,072 Q206L possibly damaging Het
Tmem59l C T 8: 70,484,387 W310* probably null Het
Tnrc6c T G 11: 117,721,674 N379K probably damaging Het
Vmn1r76 A C 7: 11,930,325 F286V probably benign Het
Xdh T C 17: 73,918,418 D463G probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Zfp263 T A 16: 3,749,430 H536Q probably damaging Het
Zfp607a T A 7: 27,879,311 F602Y probably damaging Het
Other mutations in Krt36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Krt36 APN 11 100102948 missense probably damaging 0.98
IGL01737:Krt36 APN 11 100104120 missense possibly damaging 0.62
IGL02388:Krt36 APN 11 100105164 nonsense probably null
IGL02985:Krt36 APN 11 100103179 missense probably benign 0.32
R0393:Krt36 UTSW 11 100104114 missense possibly damaging 0.91
R0617:Krt36 UTSW 11 100102275 missense probably damaging 1.00
R0930:Krt36 UTSW 11 100103399 missense probably damaging 1.00
R1166:Krt36 UTSW 11 100102828 missense probably benign 0.00
R1587:Krt36 UTSW 11 100102302 missense probably damaging 1.00
R1750:Krt36 UTSW 11 100104058 missense probably benign 0.00
R1826:Krt36 UTSW 11 100103030 splice site probably benign
R1846:Krt36 UTSW 11 100105548 missense probably damaging 1.00
R2208:Krt36 UTSW 11 100102939 missense probably damaging 0.96
R4303:Krt36 UTSW 11 100103413 missense possibly damaging 0.59
R5140:Krt36 UTSW 11 100103502 missense probably damaging 1.00
R5719:Krt36 UTSW 11 100104161 missense possibly damaging 0.95
R5944:Krt36 UTSW 11 100105313 missense probably benign
R6188:Krt36 UTSW 11 100102420 missense probably benign 0.00
R6271:Krt36 UTSW 11 100104472 nonsense probably null
R6809:Krt36 UTSW 11 100105509 missense probably benign 0.00
R6856:Krt36 UTSW 11 100103390 missense probably damaging 1.00
R7153:Krt36 UTSW 11 100105146 nonsense probably null
R7602:Krt36 UTSW 11 100102960 missense probably benign 0.00
R7822:Krt36 UTSW 11 100104140 missense possibly damaging 0.86
R7894:Krt36 UTSW 11 100105235 missense probably damaging 1.00
R7977:Krt36 UTSW 11 100105235 missense probably damaging 1.00
R8234:Krt36 UTSW 11 100104201 missense probably damaging 1.00
Z1088:Krt36 UTSW 11 100104189 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGCTGACCTCTTTGAACATGCCC -3'
(R):5'- TGTAGGTATGAGACGGAGTTGTCCC -3'

Sequencing Primer
(F):5'- gcaaatgacttcacatctttatgac -3'
(R):5'- TTGTGTAAGGCTGACCTGGA -3'
Posted On2014-01-15