Incidental Mutation 'R1180:Mstn'
ID101436
Institutional Source Beutler Lab
Gene Symbol Mstn
Ensembl Gene ENSMUSG00000026100
Gene Namemyostatin
SynonymsGdf8
MMRRC Submission 039252-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R1180 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53061640-53068079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53064008 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 168 (T168S)
Ref Sequence ENSEMBL: ENSMUSP00000140249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027269] [ENSMUST00000191197]
Predicted Effect probably benign
Transcript: ENSMUST00000027269
AA Change: T168S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027269
Gene: ENSMUSG00000026100
AA Change: T168S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 38 266 1.3e-30 PFAM
TGFB 282 376 2.31e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191197
AA Change: T168S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140249
Gene: ENSMUSG00000026100
AA Change: T168S

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 13 188 1.3e-29 PFAM
Meta Mutation Damage Score 0.1141 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.5%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein negatively regulates skeletal muscle cell proliferation and differentiation. Homozygous knockout mice for this gene exhibit increased muscle mass and bone density, and reduced adiposity. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit markedly increased size of striated muscle due to both hyperplasia and hypertrophy, reduced adiposity, and increased bone mineral density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,717 D281E probably benign Het
Adam24 T G 8: 40,681,428 V645G probably damaging Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Cadps A G 14: 12,457,836 probably benign Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Chd8 A C 14: 52,221,108 S848A probably damaging Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cpd T C 11: 76,801,753 T753A possibly damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Dock4 A G 12: 40,640,414 E173G possibly damaging Het
EU599041 G A 7: 43,226,307 noncoding transcript Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Fsip2 T C 2: 82,975,226 Y630H probably damaging Het
Gprin3 C A 6: 59,354,936 V129F possibly damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hoxa3 A C 6: 52,170,402 Y290* probably null Het
Htra4 G T 8: 25,033,719 L277I probably damaging Het
Jak2 A G 19: 29,282,499 Y266C probably damaging Het
Kif6 T A 17: 49,832,256 probably benign Het
Kiz C T 2: 146,970,007 R679C unknown Het
Kyat3 A C 3: 142,737,770 probably null Het
Mipep G A 14: 60,834,056 V537I probably damaging Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Mx2 G A 16: 97,556,009 R434H probably damaging Het
Myh6 A G 14: 54,944,468 I1792T possibly damaging Het
Myo16 T C 8: 10,396,908 S450P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Pdzd3 T A 9: 44,249,246 D284V probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psmd8 A T 7: 29,175,400 V248E probably benign Het
Ranbp2 A G 10: 58,465,463 Y646C probably damaging Het
Samsn1 C T 16: 75,873,648 G189E probably damaging Het
Sec61g A C 11: 16,504,722 probably benign Het
Sfmbt2 C T 2: 10,402,066 H59Y probably damaging Het
Shb T C 4: 45,423,996 I486V possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spag16 G A 1: 69,923,658 probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tk1 A G 11: 117,822,095 probably null Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ube2q2 T C 9: 55,195,416 probably benign Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Zfp474 C T 18: 52,638,742 Q156* probably null Het
Other mutations in Mstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Mstn APN 1 53061997 missense possibly damaging 0.47
IGL01432:Mstn APN 1 53066530 missense possibly damaging 0.65
IGL02009:Mstn APN 1 53062150 splice site probably benign
IGL02547:Mstn APN 1 53064125 missense probably benign 0.08
PIT4403001:Mstn UTSW 1 53061785 missense probably benign 0.00
R0499:Mstn UTSW 1 53063984 missense probably damaging 1.00
R0556:Mstn UTSW 1 53064125 missense probably benign 0.08
R0730:Mstn UTSW 1 53061794 missense possibly damaging 0.81
R1472:Mstn UTSW 1 53061998 missense probably damaging 0.99
R1659:Mstn UTSW 1 53064077 nonsense probably null
R1676:Mstn UTSW 1 53062065 missense probably benign 0.08
R1753:Mstn UTSW 1 53066558 missense probably damaging 1.00
R3852:Mstn UTSW 1 53061971 missense possibly damaging 0.78
R4773:Mstn UTSW 1 53062108 missense probably benign 0.18
R4938:Mstn UTSW 1 53066423 missense possibly damaging 0.90
R6000:Mstn UTSW 1 53061669 start gained probably benign
R6393:Mstn UTSW 1 53066489 missense probably benign 0.00
R6991:Mstn UTSW 1 53061941 missense probably benign 0.02
R7018:Mstn UTSW 1 53064084 missense possibly damaging 0.51
R7077:Mstn UTSW 1 53064249 missense probably benign 0.30
R7170:Mstn UTSW 1 53066395 missense probably damaging 1.00
R7300:Mstn UTSW 1 53064080 missense probably benign 0.13
R7486:Mstn UTSW 1 53063969 missense probably damaging 1.00
R8063:Mstn UTSW 1 53066448 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAGGGTTCCTTCCTCCAGACTGAC -3'
(R):5'- GCTGTTTGAGCCAATTTTGCAACAC -3'

Sequencing Primer
(F):5'- GCTAGAGCAACTATTTTCTCTGATG -3'
(R):5'- AACACTGTCTTCACATCAATACTCTG -3'
Posted On2014-01-15