Incidental Mutation 'R1180:Utp14b'
ID101442
Institutional Source Beutler Lab
Gene Symbol Utp14b
Ensembl Gene ENSMUSG00000079470
Gene NameUTP14B small subunit processome component
Synonyms4932411L21Rik, jsd
MMRRC Submission 039252-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1180 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location78658038-78671512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78665445 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 353 (N353K)
Ref Sequence ENSEMBL: ENSMUSP00000121391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000053760] [ENSMUST00000134566] [ENSMUST00000142704] [ENSMUST00000151622]
Predicted Effect probably benign
Transcript: ENSMUST00000035779
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053760
AA Change: N353K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052149
Gene: ENSMUSG00000079470
AA Change: N353K

DomainStartEndE-ValueType
Pfam:Utp14 39 744 6.4e-205 PFAM
low complexity region 758 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134566
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142704
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151622
AA Change: N353K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121391
Gene: ENSMUSG00000079470
AA Change: N353K

DomainStartEndE-ValueType
Pfam:Utp14 45 743 6e-163 PFAM
low complexity region 758 778 N/A INTRINSIC
Meta Mutation Damage Score 0.1564 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.5%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Homozygous males are sterile with spermatogonial arrest and elevated intratesticular testosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,717 D281E probably benign Het
Adam24 T G 8: 40,681,428 V645G probably damaging Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Cadps A G 14: 12,457,836 probably benign Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Chd8 A C 14: 52,221,108 S848A probably damaging Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cpd T C 11: 76,801,753 T753A possibly damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Dock4 A G 12: 40,640,414 E173G possibly damaging Het
EU599041 G A 7: 43,226,307 noncoding transcript Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Fsip2 T C 2: 82,975,226 Y630H probably damaging Het
Gprin3 C A 6: 59,354,936 V129F possibly damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hoxa3 A C 6: 52,170,402 Y290* probably null Het
Htra4 G T 8: 25,033,719 L277I probably damaging Het
Jak2 A G 19: 29,282,499 Y266C probably damaging Het
Kif6 T A 17: 49,832,256 probably benign Het
Kiz C T 2: 146,970,007 R679C unknown Het
Kyat3 A C 3: 142,737,770 probably null Het
Mipep G A 14: 60,834,056 V537I probably damaging Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Mstn A T 1: 53,064,008 T168S possibly damaging Het
Mx2 G A 16: 97,556,009 R434H probably damaging Het
Myh6 A G 14: 54,944,468 I1792T possibly damaging Het
Myo16 T C 8: 10,396,908 S450P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Pdzd3 T A 9: 44,249,246 D284V probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psmd8 A T 7: 29,175,400 V248E probably benign Het
Ranbp2 A G 10: 58,465,463 Y646C probably damaging Het
Samsn1 C T 16: 75,873,648 G189E probably damaging Het
Sec61g A C 11: 16,504,722 probably benign Het
Sfmbt2 C T 2: 10,402,066 H59Y probably damaging Het
Shb T C 4: 45,423,996 I486V possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spag16 G A 1: 69,923,658 probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tk1 A G 11: 117,822,095 probably null Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ube2q2 T C 9: 55,195,416 probably benign Het
Zfp474 C T 18: 52,638,742 Q156* probably null Het
Other mutations in Utp14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Utp14b APN 1 78664545 missense probably damaging 1.00
IGL01837:Utp14b APN 1 78664919 missense probably damaging 1.00
IGL02895:Utp14b APN 1 78664607 missense possibly damaging 0.61
IGL03165:Utp14b APN 1 78664520 missense probably damaging 0.97
IGL03210:Utp14b APN 1 78665551 missense probably benign 0.02
R0662:Utp14b UTSW 1 78664999 missense probably damaging 1.00
R0671:Utp14b UTSW 1 78664735 missense probably benign 0.00
R0736:Utp14b UTSW 1 78665272 missense probably damaging 1.00
R1430:Utp14b UTSW 1 78666394 missense probably benign 0.25
R1448:Utp14b UTSW 1 78665445 missense probably damaging 1.00
R1641:Utp14b UTSW 1 78665939 missense probably benign 0.08
R1867:Utp14b UTSW 1 78665431 missense probably damaging 1.00
R3054:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3055:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3056:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3426:Utp14b UTSW 1 78665339 missense probably damaging 1.00
R3744:Utp14b UTSW 1 78665256 missense probably benign 0.03
R4204:Utp14b UTSW 1 78664822 missense probably benign 0.12
R5570:Utp14b UTSW 1 78665401 missense probably damaging 1.00
R5574:Utp14b UTSW 1 78666409 missense probably damaging 1.00
R5958:Utp14b UTSW 1 78664942 nonsense probably null
R5958:Utp14b UTSW 1 78664943 missense probably damaging 1.00
R6173:Utp14b UTSW 1 78665837 missense probably benign 0.03
R6173:Utp14b UTSW 1 78665840 missense probably benign 0.00
R7258:Utp14b UTSW 1 78664974 missense probably benign 0.30
R7784:Utp14b UTSW 1 78664943 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGAAAGACTGCCCAAATGCTGC -3'
(R):5'- TCCCTCACTCTCAGAAGACACATGG -3'

Sequencing Primer
(F):5'- TGCTGCATTGCAAGAACTG -3'
(R):5'- CTCAGGCATCTGTTCAGGATCG -3'
Posted On2014-01-15