Incidental Mutation 'R1180:Mrpl44'
ID101444
Institutional Source Beutler Lab
Gene Symbol Mrpl44
Ensembl Gene ENSMUSG00000026248
Gene Namemitochondrial ribosomal protein L44
Synonyms1810030E18Rik, 5730593H20Rik
MMRRC Submission 039252-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1180 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location79776018-79781445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79777960 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 94 (N94K)
Ref Sequence ENSEMBL: ENSMUSP00000027464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027464] [ENSMUST00000143368]
Predicted Effect probably damaging
Transcript: ENSMUST00000027464
AA Change: N94K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027464
Gene: ENSMUSG00000026248
AA Change: N94K

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
PDB:4CE4|H 67 333 1e-160 PDB
SCOP:d1jfza_ 72 224 5e-23 SMART
Blast:RIBOc 86 228 2e-90 BLAST
Blast:DSRM 237 288 6e-8 BLAST
SCOP:d1di2a_ 237 304 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143368
SMART Domains Protein: ENSMUSP00000123303
Gene: ENSMUSG00000073643

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
Blast:WD40 145 182 6e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189176
Meta Mutation Damage Score 0.6829 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.5%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,717 D281E probably benign Het
Adam24 T G 8: 40,681,428 V645G probably damaging Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Cadps A G 14: 12,457,836 probably benign Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Chd8 A C 14: 52,221,108 S848A probably damaging Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cpd T C 11: 76,801,753 T753A possibly damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Dock4 A G 12: 40,640,414 E173G possibly damaging Het
EU599041 G A 7: 43,226,307 noncoding transcript Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Fsip2 T C 2: 82,975,226 Y630H probably damaging Het
Gprin3 C A 6: 59,354,936 V129F possibly damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hoxa3 A C 6: 52,170,402 Y290* probably null Het
Htra4 G T 8: 25,033,719 L277I probably damaging Het
Jak2 A G 19: 29,282,499 Y266C probably damaging Het
Kif6 T A 17: 49,832,256 probably benign Het
Kiz C T 2: 146,970,007 R679C unknown Het
Kyat3 A C 3: 142,737,770 probably null Het
Mipep G A 14: 60,834,056 V537I probably damaging Het
Mstn A T 1: 53,064,008 T168S possibly damaging Het
Mx2 G A 16: 97,556,009 R434H probably damaging Het
Myh6 A G 14: 54,944,468 I1792T possibly damaging Het
Myo16 T C 8: 10,396,908 S450P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Pdzd3 T A 9: 44,249,246 D284V probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psmd8 A T 7: 29,175,400 V248E probably benign Het
Ranbp2 A G 10: 58,465,463 Y646C probably damaging Het
Samsn1 C T 16: 75,873,648 G189E probably damaging Het
Sec61g A C 11: 16,504,722 probably benign Het
Sfmbt2 C T 2: 10,402,066 H59Y probably damaging Het
Shb T C 4: 45,423,996 I486V possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spag16 G A 1: 69,923,658 probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tk1 A G 11: 117,822,095 probably null Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ube2q2 T C 9: 55,195,416 probably benign Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Zfp474 C T 18: 52,638,742 Q156* probably null Het
Other mutations in Mrpl44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Mrpl44 APN 1 79781004 missense probably benign 0.01
IGL02633:Mrpl44 APN 1 79776145 missense probably benign 0.02
R0054:Mrpl44 UTSW 1 79779495 missense probably damaging 1.00
R0054:Mrpl44 UTSW 1 79779495 missense probably damaging 1.00
R0909:Mrpl44 UTSW 1 79779653 missense probably benign 0.43
R1347:Mrpl44 UTSW 1 79777952 missense probably damaging 1.00
R1347:Mrpl44 UTSW 1 79777952 missense probably damaging 1.00
R1448:Mrpl44 UTSW 1 79777960 missense probably damaging 0.99
R3689:Mrpl44 UTSW 1 79779649 nonsense probably null
R3690:Mrpl44 UTSW 1 79779649 nonsense probably null
R4533:Mrpl44 UTSW 1 79776254 missense possibly damaging 0.91
R4818:Mrpl44 UTSW 1 79780977 missense probably benign 0.00
R4893:Mrpl44 UTSW 1 79777865 missense probably damaging 0.97
R6178:Mrpl44 UTSW 1 79778178 missense possibly damaging 0.76
X0018:Mrpl44 UTSW 1 79778075 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGCAGAGCAGCCTAATGTGATGTG -3'
(R):5'- GGCAAGTCTGGGAATTCGTCTTCG -3'

Sequencing Primer
(F):5'- ACGGACTGCCAGTGGTTATC -3'
(R):5'- CTGGGAATTCGTCTTCGAGAAAC -3'
Posted On2014-01-15