Incidental Mutation 'R1180:Samsn1'
ID101516
Institutional Source Beutler Lab
Gene Symbol Samsn1
Ensembl Gene ENSMUSG00000022876
Gene NameSAM domain, SH3 domain and nuclear localization signals, 1
Synonyms4930571B16Rik, Hacs1
MMRRC Submission 039252-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1180 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location75858793-76022281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75873648 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 189 (G189E)
Ref Sequence ENSEMBL: ENSMUSP00000109877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114239] [ENSMUST00000114240]
PDB Structure Solution structure of the Sterile Alpha Motif (SAM) domain of mouse SAMSN1 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000114239
AA Change: G189E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109877
Gene: ENSMUSG00000022876
AA Change: G189E

DomainStartEndE-ValueType
Pfam:SLY 17 164 4.7e-57 PFAM
SH3 166 223 8.78e-4 SMART
SAM 238 305 7.6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114240
SMART Domains Protein: ENSMUSP00000109878
Gene: ENSMUSG00000022876

DomainStartEndE-ValueType
low complexity region 69 80 N/A INTRINSIC
Pfam:SLY 146 293 1.1e-55 PFAM
SH3 295 352 8.78e-4 SMART
SAM 367 434 7.6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226794
Meta Mutation Damage Score 0.9633 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.5%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SAMSN1 is a member of a novel gene family of putative adaptors and scaffold proteins containing SH3 and SAM (sterile alpha motif) domains (Claudio et al., 2001 [PubMed 11536050]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced adaptive immunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,717 D281E probably benign Het
Adam24 T G 8: 40,681,428 V645G probably damaging Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Cadps A G 14: 12,457,836 probably benign Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Chd8 A C 14: 52,221,108 S848A probably damaging Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cpd T C 11: 76,801,753 T753A possibly damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Dock4 A G 12: 40,640,414 E173G possibly damaging Het
EU599041 G A 7: 43,226,307 noncoding transcript Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Fsip2 T C 2: 82,975,226 Y630H probably damaging Het
Gprin3 C A 6: 59,354,936 V129F possibly damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hoxa3 A C 6: 52,170,402 Y290* probably null Het
Htra4 G T 8: 25,033,719 L277I probably damaging Het
Jak2 A G 19: 29,282,499 Y266C probably damaging Het
Kif6 T A 17: 49,832,256 probably benign Het
Kiz C T 2: 146,970,007 R679C unknown Het
Kyat3 A C 3: 142,737,770 probably null Het
Mipep G A 14: 60,834,056 V537I probably damaging Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Mstn A T 1: 53,064,008 T168S possibly damaging Het
Mx2 G A 16: 97,556,009 R434H probably damaging Het
Myh6 A G 14: 54,944,468 I1792T possibly damaging Het
Myo16 T C 8: 10,396,908 S450P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Pdzd3 T A 9: 44,249,246 D284V probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psmd8 A T 7: 29,175,400 V248E probably benign Het
Ranbp2 A G 10: 58,465,463 Y646C probably damaging Het
Sec61g A C 11: 16,504,722 probably benign Het
Sfmbt2 C T 2: 10,402,066 H59Y probably damaging Het
Shb T C 4: 45,423,996 I486V possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spag16 G A 1: 69,923,658 probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tk1 A G 11: 117,822,095 probably null Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ube2q2 T C 9: 55,195,416 probably benign Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Zfp474 C T 18: 52,638,742 Q156* probably null Het
Other mutations in Samsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Samsn1 APN 16 75909120 splice site probably benign
IGL02220:Samsn1 APN 16 75883875 critical splice donor site probably null
R0455:Samsn1 UTSW 16 75945225 unclassified noncoding transcript
R1136:Samsn1 UTSW 16 75873520 missense probably null 0.00
R1140:Samsn1 UTSW 16 75888742 missense possibly damaging 0.73
R1772:Samsn1 UTSW 16 75870775 missense probably benign 0.01
R1968:Samsn1 UTSW 16 75945573 exon noncoding transcript
R4035:Samsn1 UTSW 16 75909185 start codon destroyed probably null 0.99
R4372:Samsn1 UTSW 16 75859456 missense possibly damaging 0.80
R4725:Samsn1 UTSW 16 75945329 unclassified noncoding transcript
R4779:Samsn1 UTSW 16 75947289 exon noncoding transcript
R4795:Samsn1 UTSW 16 75883845 intron probably benign
R4899:Samsn1 UTSW 16 75879103 missense probably damaging 1.00
R4905:Samsn1 UTSW 16 75876465 missense possibly damaging 0.94
R5050:Samsn1 UTSW 16 75888757 missense probably benign
R5789:Samsn1 UTSW 16 75876448 missense probably damaging 1.00
R6005:Samsn1 UTSW 16 75873514 missense probably benign 0.03
R6190:Samsn1 UTSW 16 75870915 missense probably damaging 1.00
R6218:Samsn1 UTSW 16 75945274 unclassified noncoding transcript
R6630:Samsn1 UTSW 16 75879204 missense probably benign 0.00
R7086:Samsn1 UTSW 16 75870906 missense probably benign 0.00
R8289:Samsn1 UTSW 16 75888796 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATAGTCTGGTGGTTCTCTCTTCTCCT -3'
(R):5'- GCTGCATACCTGGCTGCATGA -3'

Sequencing Primer
(F):5'- TCCTGCTTCTGGGGACC -3'
(R):5'- TTACCCAGCACATATGAGTGAG -3'
Posted On2014-01-15