Incidental Mutation 'R1180:Zfp474'
ID101524
Institutional Source Beutler Lab
Gene Symbol Zfp474
Ensembl Gene ENSMUSG00000046886
Gene Namezinc finger protein 474
Synonyms4933409D10Rik
MMRRC Submission 039252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R1180 (G1)
Quality Score129
Status Validated
Chromosome18
Chromosomal Location52615915-52639830 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 52638742 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 156 (Q156*)
Ref Sequence ENSEMBL: ENSMUSP00000147873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072666] [ENSMUST00000209270]
Predicted Effect probably null
Transcript: ENSMUST00000072666
AA Change: Q156*
SMART Domains Protein: ENSMUSP00000072453
Gene: ENSMUSG00000046886
AA Change: Q156*

DomainStartEndE-ValueType
Pfam:zf-C2HC_2 90 114 1.8e-10 PFAM
Pfam:zf-C2HC_2 161 185 3.3e-13 PFAM
Pfam:zf-C2HC_2 217 241 1.2e-10 PFAM
low complexity region 250 267 N/A INTRINSIC
Pfam:zf-C2HC_2 280 304 1.1e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000209270
AA Change: Q156*
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.5%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,717 D281E probably benign Het
Adam24 T G 8: 40,681,428 V645G probably damaging Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Cadps A G 14: 12,457,836 probably benign Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Chd8 A C 14: 52,221,108 S848A probably damaging Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cpd T C 11: 76,801,753 T753A possibly damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Dock4 A G 12: 40,640,414 E173G possibly damaging Het
EU599041 G A 7: 43,226,307 noncoding transcript Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Fsip2 T C 2: 82,975,226 Y630H probably damaging Het
Gprin3 C A 6: 59,354,936 V129F possibly damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hoxa3 A C 6: 52,170,402 Y290* probably null Het
Htra4 G T 8: 25,033,719 L277I probably damaging Het
Jak2 A G 19: 29,282,499 Y266C probably damaging Het
Kif6 T A 17: 49,832,256 probably benign Het
Kiz C T 2: 146,970,007 R679C unknown Het
Kyat3 A C 3: 142,737,770 probably null Het
Mipep G A 14: 60,834,056 V537I probably damaging Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Mstn A T 1: 53,064,008 T168S possibly damaging Het
Mx2 G A 16: 97,556,009 R434H probably damaging Het
Myh6 A G 14: 54,944,468 I1792T possibly damaging Het
Myo16 T C 8: 10,396,908 S450P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Pdzd3 T A 9: 44,249,246 D284V probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psmd8 A T 7: 29,175,400 V248E probably benign Het
Ranbp2 A G 10: 58,465,463 Y646C probably damaging Het
Samsn1 C T 16: 75,873,648 G189E probably damaging Het
Sec61g A C 11: 16,504,722 probably benign Het
Sfmbt2 C T 2: 10,402,066 H59Y probably damaging Het
Shb T C 4: 45,423,996 I486V possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spag16 G A 1: 69,923,658 probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tk1 A G 11: 117,822,095 probably null Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ube2q2 T C 9: 55,195,416 probably benign Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Other mutations in Zfp474
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp474 APN 18 52638493 missense possibly damaging 0.52
IGL01651:Zfp474 APN 18 52638583 missense probably damaging 1.00
IGL01750:Zfp474 APN 18 52639277 missense possibly damaging 0.59
IGL02013:Zfp474 APN 18 52638899 missense possibly damaging 0.86
PIT4469001:Zfp474 UTSW 18 52638719 missense possibly damaging 0.77
PIT4618001:Zfp474 UTSW 18 52638404 missense probably damaging 0.97
R0615:Zfp474 UTSW 18 52638349 missense probably benign 0.02
R1178:Zfp474 UTSW 18 52638742 nonsense probably null
R1610:Zfp474 UTSW 18 52638365 missense probably benign
R1819:Zfp474 UTSW 18 52638800 missense probably damaging 1.00
R4854:Zfp474 UTSW 18 52638431 missense possibly damaging 0.59
R6270:Zfp474 UTSW 18 52638364 missense probably benign
R7574:Zfp474 UTSW 18 52639189 missense probably benign 0.00
R8194:Zfp474 UTSW 18 52639157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTCCGGGAACAGTGATTCTATC -3'
(R):5'- CCACAATTTGGGCAAGGCACAAG -3'

Sequencing Primer
(F):5'- CGCTCAAGTCGAATTATGTCAG -3'
(R):5'- TAACAGATGAGAGTCCTTGGTC -3'
Posted On2014-01-15