Incidental Mutation 'R1180:Apcdd1'
ID 101528
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
MMRRC Submission 039252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R1180 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62937097 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 145 (Y145F)
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably damaging
Transcript: ENSMUST00000096554
AA Change: Y145F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: Y145F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163716
AA Change: Y145F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: Y145F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Meta Mutation Damage Score 0.3554 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.5%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,717 D281E probably benign Het
Adam24 T G 8: 40,681,428 V645G probably damaging Het
Cadps A G 14: 12,457,836 probably benign Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Chd8 A C 14: 52,221,108 S848A probably damaging Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cpd T C 11: 76,801,753 T753A possibly damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Dock4 A G 12: 40,640,414 E173G possibly damaging Het
EU599041 G A 7: 43,226,307 noncoding transcript Het
Fer1l6 G A 15: 58,602,311 probably benign Het
Flt3 T C 5: 147,341,238 D842G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Fsip2 T C 2: 82,975,226 Y630H probably damaging Het
Gprin3 C A 6: 59,354,936 V129F possibly damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hoxa3 A C 6: 52,170,402 Y290* probably null Het
Htra4 G T 8: 25,033,719 L277I probably damaging Het
Jak2 A G 19: 29,282,499 Y266C probably damaging Het
Kif6 T A 17: 49,832,256 probably benign Het
Kiz C T 2: 146,970,007 R679C unknown Het
Kyat3 A C 3: 142,737,770 probably null Het
Mipep G A 14: 60,834,056 V537I probably damaging Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Mstn A T 1: 53,064,008 T168S possibly damaging Het
Mx2 G A 16: 97,556,009 R434H probably damaging Het
Myh6 A G 14: 54,944,468 I1792T possibly damaging Het
Myo16 T C 8: 10,396,908 S450P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Pdzd3 T A 9: 44,249,246 D284V probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psmd8 A T 7: 29,175,400 V248E probably benign Het
Ranbp2 A G 10: 58,465,463 Y646C probably damaging Het
Samsn1 C T 16: 75,873,648 G189E probably damaging Het
Sec61g A C 11: 16,504,722 probably benign Het
Sfmbt2 C T 2: 10,402,066 H59Y probably damaging Het
Shb T C 4: 45,423,996 I486V possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spag16 G A 1: 69,923,658 probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tk1 A G 11: 117,822,095 probably null Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ube2q2 T C 9: 55,195,416 probably benign Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Zfp474 C T 18: 52,638,742 Q156* probably null Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACACGCTGTTGGCTTTATCTAGCTC -3'
(R):5'- GCAAAGTTCACAGCCTTGGTGC -3'

Sequencing Primer
(F):5'- CTGTGAAGTAAGGTCGGGTC -3'
(R):5'- TGCACTCGTGGTTACTCTC -3'
Posted On 2014-01-15