Incidental Mutation 'R1181:Bnipl'
ID101542
Institutional Source Beutler Lab
Gene Symbol Bnipl
Ensembl Gene ENSMUSG00000028115
Gene NameBCL2/adenovirus E1B 19kD interacting protein like
SynonymsPP753, BNIPL1, 1700128A13Rik, BNIP-S, BNIPL2, BNIPL, BNIPL-2, BNIPL-1
MMRRC Submission 039253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1181 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95241271-95251193 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 95245649 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090815] [ENSMUST00000098871] [ENSMUST00000107195] [ENSMUST00000107197] [ENSMUST00000125515] [ENSMUST00000137250]
Predicted Effect probably benign
Transcript: ENSMUST00000090815
SMART Domains Protein: ENSMUSP00000088324
Gene: ENSMUSG00000068860

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PMSI1 23 345 3.1e-144 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098871
SMART Domains Protein: ENSMUSP00000096468
Gene: ENSMUSG00000028115

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:BNIP2 48 178 4.5e-38 PFAM
Pfam:CRAL_TRIO_2 162 273 7.7e-16 PFAM
Pfam:CRAL_TRIO 196 263 3.2e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107195
SMART Domains Protein: ENSMUSP00000102813
Gene: ENSMUSG00000028115

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
SEC14 193 348 7.89e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107197
SMART Domains Protein: ENSMUSP00000102815
Gene: ENSMUSG00000068860

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PMSI1 23 130 1.8e-32 PFAM
Pfam:PMSI1 121 184 1.2e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125515
SMART Domains Protein: ENSMUSP00000120545
Gene: ENSMUSG00000028115

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:BNIP2 48 178 3.7e-38 PFAM
Pfam:CRAL_TRIO_2 168 259 7.5e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137250
SMART Domains Protein: ENSMUSP00000115197
Gene: ENSMUSG00000028115

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
SEC14 165 320 7.89e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176070
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.9%
  • 10x: 93.9%
  • 20x: 84.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with several other proteins, such as BCL2, ARHGAP1, MIF and GFER. It may function as a bridge molecule between BCL2 and ARHGAP1/CDC42 in promoting cell death. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T A 19: 4,872,610 Q64L probably benign Het
Ankrd12 T C 17: 66,042,574 N88S probably benign Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Bod1 T C 11: 31,666,943 probably benign Het
Cbarp G T 10: 80,135,494 H166N probably damaging Het
Cdr2l T A 11: 115,394,179 I447N probably damaging Het
Cped1 T G 6: 22,215,562 I698M probably damaging Het
Ecm1 G A 3: 95,735,350 H404Y possibly damaging Het
Ehbp1 C T 11: 22,062,831 V902I probably benign Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fastk C T 5: 24,441,731 probably null Het
Gm6797 T A X: 8,641,765 noncoding transcript Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgf G C 5: 16,618,925 G707R probably damaging Het
Klhl5 T C 5: 65,162,885 M594T probably damaging Het
Kyat3 A C 3: 142,737,770 probably null Het
Mettl14 C T 3: 123,374,002 G236S probably damaging Het
Nob1 G A 8: 107,421,490 P107S probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr1463 C A 19: 13,234,831 H194N probably benign Het
Olfr444 T A 6: 42,955,558 L20Q probably benign Het
Olfr503 C A 7: 108,545,302 T257N probably benign Het
Olfr676 T A 7: 105,035,814 N205K probably damaging Het
Olfr808 A G 10: 129,768,164 I223V probably benign Het
Pald1 A G 10: 61,347,587 probably benign Het
Pds5a A T 5: 65,627,202 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekha2 A C 8: 25,059,202 S189A probably benign Het
Prune2 T C 19: 17,123,105 V1991A probably benign Het
Sec61g A C 11: 16,504,722 probably benign Het
Serinc3 T C 2: 163,625,526 K445R probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slfn8 T C 11: 83,016,745 E324G probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tas2r121 A T 6: 132,700,169 I280N probably damaging Het
Tbc1d7 T C 13: 43,153,139 I242M probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Trim66 C T 7: 109,484,577 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Tulp3 A T 6: 128,325,952 H301Q possibly damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Zfp454 T C 11: 50,873,586 K229E probably damaging Het
Other mutations in Bnipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Bnipl APN 3 95242734 missense probably damaging 1.00
IGL02089:Bnipl APN 3 95250266 splice site probably benign
IGL02273:Bnipl APN 3 95245775 missense possibly damaging 0.58
IGL03250:Bnipl APN 3 95244139 splice site probably benign
R0524:Bnipl UTSW 3 95249829 missense probably benign 0.27
R1926:Bnipl UTSW 3 95243043 missense probably damaging 1.00
R2072:Bnipl UTSW 3 95244211 missense probably damaging 1.00
R2126:Bnipl UTSW 3 95245683 missense probably damaging 1.00
R2196:Bnipl UTSW 3 95249870 missense possibly damaging 0.83
R2898:Bnipl UTSW 3 95243049 missense probably benign 0.44
R7781:Bnipl UTSW 3 95244175 missense probably damaging 1.00
R7885:Bnipl UTSW 3 95250240 missense probably benign
R7968:Bnipl UTSW 3 95250240 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTCAGTCACTGTAGCTGTTGTTTT -3'
(R):5'- TCCTGTGTGTTTTAGATGACTTGCCC -3'

Sequencing Primer
(F):5'- GCTGTTGTTTTAATGTATCATtgtgc -3'
(R):5'- GTCATCGCTGGAGAGTGTTT -3'
Posted On2014-01-15