Incidental Mutation 'R1181:Gstm1'
ID101546
Institutional Source Beutler Lab
Gene Symbol Gstm1
Ensembl Gene ENSMUSG00000058135
Gene Nameglutathione S-transferase, mu 1
SynonymsGstb-1, Gstb1
MMRRC Submission 039253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1181 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108012255-108017973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108014811 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 170 (F170S)
Ref Sequence ENSEMBL: ENSMUSP00000004140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004140] [ENSMUST00000126593] [ENSMUST00000153314]
Predicted Effect probably damaging
Transcript: ENSMUST00000004140
AA Change: F170S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004140
Gene: ENSMUSG00000058135
AA Change: F170S

DomainStartEndE-ValueType
Pfam:GST_N 3 82 1.3e-20 PFAM
Pfam:GST_C_3 40 190 5.2e-11 PFAM
Pfam:GST_C 104 192 3.7e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000126593
AA Change: F196S

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118874
Gene: ENSMUSG00000058135
AA Change: F196S

DomainStartEndE-ValueType
Pfam:GST_N 3 82 8.3e-24 PFAM
Pfam:GST_C 104 201 6.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138374
Predicted Effect probably damaging
Transcript: ENSMUST00000153314
AA Change: F146S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123481
Gene: ENSMUSG00000058135
AA Change: F146S

DomainStartEndE-ValueType
Pfam:GST_N 1 23 1.7e-7 PFAM
Pfam:GST_C 45 168 1.2e-18 PFAM
Pfam:GST_C_3 92 166 8.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198532
Meta Mutation Damage Score 0.8794 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.9%
  • 10x: 93.9%
  • 20x: 84.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for the deletion of this gene display a reduced ability to metabolize 1,2-dichloro-4-nitrobenzene. Mice homozygous for a different knock-out allele exhibit abnormal behavior, altered response to valproic acid, and increased serotonin and dopamine levels in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T A 19: 4,872,610 Q64L probably benign Het
Ankrd12 T C 17: 66,042,574 N88S probably benign Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Bnipl C A 3: 95,245,649 probably null Het
Bod1 T C 11: 31,666,943 probably benign Het
Cbarp G T 10: 80,135,494 H166N probably damaging Het
Cdr2l T A 11: 115,394,179 I447N probably damaging Het
Cped1 T G 6: 22,215,562 I698M probably damaging Het
Ecm1 G A 3: 95,735,350 H404Y possibly damaging Het
Ehbp1 C T 11: 22,062,831 V902I probably benign Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fastk C T 5: 24,441,731 probably null Het
Gm6797 T A X: 8,641,765 noncoding transcript Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Hgf G C 5: 16,618,925 G707R probably damaging Het
Klhl5 T C 5: 65,162,885 M594T probably damaging Het
Kyat3 A C 3: 142,737,770 probably null Het
Mettl14 C T 3: 123,374,002 G236S probably damaging Het
Nob1 G A 8: 107,421,490 P107S probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr1463 C A 19: 13,234,831 H194N probably benign Het
Olfr444 T A 6: 42,955,558 L20Q probably benign Het
Olfr503 C A 7: 108,545,302 T257N probably benign Het
Olfr676 T A 7: 105,035,814 N205K probably damaging Het
Olfr808 A G 10: 129,768,164 I223V probably benign Het
Pald1 A G 10: 61,347,587 probably benign Het
Pds5a A T 5: 65,627,202 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekha2 A C 8: 25,059,202 S189A probably benign Het
Prune2 T C 19: 17,123,105 V1991A probably benign Het
Sec61g A C 11: 16,504,722 probably benign Het
Serinc3 T C 2: 163,625,526 K445R probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slfn8 T C 11: 83,016,745 E324G probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tas2r121 A T 6: 132,700,169 I280N probably damaging Het
Tbc1d7 T C 13: 43,153,139 I242M probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Trim66 C T 7: 109,484,577 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Tulp3 A T 6: 128,325,952 H301Q possibly damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Zfp454 T C 11: 50,873,586 K229E probably damaging Het
Other mutations in Gstm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0335:Gstm1 UTSW 3 108012696 missense possibly damaging 0.87
R0458:Gstm1 UTSW 3 108017363 missense probably benign 0.01
R0907:Gstm1 UTSW 3 108017380 missense probably damaging 1.00
R1069:Gstm1 UTSW 3 108012748 missense probably damaging 1.00
R1180:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R1998:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R2000:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R4483:Gstm1 UTSW 3 108016518 critical splice donor site probably null
R4857:Gstm1 UTSW 3 108016408 missense possibly damaging 0.67
R5192:Gstm1 UTSW 3 108014943 critical splice donor site probably null
R5262:Gstm1 UTSW 3 108016363 missense probably benign 0.01
R5356:Gstm1 UTSW 3 108012736 missense probably benign 0.00
R5485:Gstm1 UTSW 3 108017404 missense probably damaging 1.00
R6323:Gstm1 UTSW 3 108017747 missense probably benign 0.44
R7165:Gstm1 UTSW 3 108016377 missense probably benign
R7250:Gstm1 UTSW 3 108016393 missense probably damaging 0.98
R7638:Gstm1 UTSW 3 108014550 intron probably null
X0023:Gstm1 UTSW 3 108012727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAACAGGAGAATGAGGTTGTGC -3'
(R):5'- TGAGTCTAAAGGTGGTGACAGCCAG -3'

Sequencing Primer
(F):5'- ggactcagaatcgcatcaatc -3'
(R):5'- GAGTTCTTGAAGACCATCCCTGAG -3'
Posted On2014-01-15