Incidental Mutation 'R1181:Tas2r121'
ID101568
Institutional Source Beutler Lab
Gene Symbol Tas2r121
Ensembl Gene ENSMUSG00000071150
Gene Nametaste receptor, type 2, member 121
SynonymsTas2r21, T2R21, mGR21, mT2r48
MMRRC Submission 039253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1181 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132700090-132701007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132700169 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 280 (I280N)
Ref Sequence ENSEMBL: ENSMUSP00000093044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095395]
Predicted Effect probably damaging
Transcript: ENSMUST00000095395
AA Change: I280N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093044
Gene: ENSMUSG00000071150
AA Change: I280N

DomainStartEndE-ValueType
Pfam:TAS2R 1 300 4.5e-108 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.9%
  • 10x: 93.9%
  • 20x: 84.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T A 19: 4,872,610 Q64L probably benign Het
Ankrd12 T C 17: 66,042,574 N88S probably benign Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Bnipl C A 3: 95,245,649 probably null Het
Bod1 T C 11: 31,666,943 probably benign Het
Cbarp G T 10: 80,135,494 H166N probably damaging Het
Cdr2l T A 11: 115,394,179 I447N probably damaging Het
Cped1 T G 6: 22,215,562 I698M probably damaging Het
Ecm1 G A 3: 95,735,350 H404Y possibly damaging Het
Ehbp1 C T 11: 22,062,831 V902I probably benign Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fastk C T 5: 24,441,731 probably null Het
Gm6797 T A X: 8,641,765 noncoding transcript Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgf G C 5: 16,618,925 G707R probably damaging Het
Klhl5 T C 5: 65,162,885 M594T probably damaging Het
Kyat3 A C 3: 142,737,770 probably null Het
Mettl14 C T 3: 123,374,002 G236S probably damaging Het
Nob1 G A 8: 107,421,490 P107S probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr1463 C A 19: 13,234,831 H194N probably benign Het
Olfr444 T A 6: 42,955,558 L20Q probably benign Het
Olfr503 C A 7: 108,545,302 T257N probably benign Het
Olfr676 T A 7: 105,035,814 N205K probably damaging Het
Olfr808 A G 10: 129,768,164 I223V probably benign Het
Pald1 A G 10: 61,347,587 probably benign Het
Pds5a A T 5: 65,627,202 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekha2 A C 8: 25,059,202 S189A probably benign Het
Prune2 T C 19: 17,123,105 V1991A probably benign Het
Sec61g A C 11: 16,504,722 probably benign Het
Serinc3 T C 2: 163,625,526 K445R probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slfn8 T C 11: 83,016,745 E324G probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tbc1d7 T C 13: 43,153,139 I242M probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Trim66 C T 7: 109,484,577 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Tulp3 A T 6: 128,325,952 H301Q possibly damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Zfp454 T C 11: 50,873,586 K229E probably damaging Het
Other mutations in Tas2r121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Tas2r121 APN 6 132700521 missense probably benign 0.28
IGL01868:Tas2r121 APN 6 132700272 missense probably benign 0.00
IGL02182:Tas2r121 APN 6 132700170 missense probably damaging 0.99
IGL02728:Tas2r121 APN 6 132700517 missense probably damaging 1.00
R0833:Tas2r121 UTSW 6 132700362 missense probably damaging 1.00
R0836:Tas2r121 UTSW 6 132700362 missense probably damaging 1.00
R1424:Tas2r121 UTSW 6 132700682 missense probably damaging 1.00
R1583:Tas2r121 UTSW 6 132700230 nonsense probably null
R2179:Tas2r121 UTSW 6 132700868 missense probably damaging 1.00
R4711:Tas2r121 UTSW 6 132700890 missense probably benign 0.28
R5274:Tas2r121 UTSW 6 132700848 missense probably damaging 1.00
R5308:Tas2r121 UTSW 6 132700517 missense possibly damaging 0.84
R5663:Tas2r121 UTSW 6 132700557 missense probably benign 0.10
R5668:Tas2r121 UTSW 6 132700793 missense possibly damaging 0.95
R5885:Tas2r121 UTSW 6 132700291 missense probably damaging 1.00
R6395:Tas2r121 UTSW 6 132700532 missense probably benign 0.23
R7552:Tas2r121 UTSW 6 132700542 missense probably benign 0.17
R8094:Tas2r121 UTSW 6 132700809 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTTGCTTATGCCTTCAGTGACAGAG -3'
(R):5'- AGCACTAAAGCCCATGTGAATGCC -3'

Sequencing Primer
(F):5'- TGTACAAGATCACACTACTGTAGC -3'
(R):5'- GAATGCCTTGAGAATTATGGTCTCC -3'
Posted On2014-01-15