Mutagenetix > Incidental Mutations

Incidental Mutation 'R1181:Pirb'

101573

Institutional Source

Beutler Lab

Gene Symbol

Pirb

Ensembl Gene

ENSMUSG00000058818

Gene Name

paired Ig-like receptor B

Synonyms

Lilrb3, Gp91

MMRRC Submission

039253-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1181 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

3711409-3720391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 3717638 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 287 (L287Q)

Ref Sequence

ENSEMBL: ENSMUSP00000077546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078451]

Predicted Effect

probably benign
Transcript: ENSMUST00000078451
AA Change: L287Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077546
Gene: ENSMUSG00000058818
AA Change: L287Q

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	34	118	1.8e-3	SMART
IG	129	315	1.2e-4	SMART
IG_like	237	302	6.2e-4	SMART
IG_like	328	415	3.4e-2	SMART
IG_like	435	502	1e-2	SMART
IG	529	618	3.6e-5	SMART
low complexity region	624	637	N/A	INTRINSIC
transmembrane domain	641	663	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129493

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136238

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155131

Coding Region Coverage

1x: 99.3%
3x: 97.9%
10x: 93.9%
20x: 84.2%

Validation Efficiency

100% (52/52)

MGI Phenotype

PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in both B and T lymphocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn3	T	A	19: 4,872,610	Q64L	probably benign	Het
Ankrd12	T	C	17: 66,042,574	N88S	probably benign	Het
Apcdd1	A	T	18: 62,937,097	Y145F	probably damaging	Het
Bnipl	C	A	3: 95,245,649		probably null	Het
Bod1	T	C	11: 31,666,943		probably benign	Het
Cbarp	G	T	10: 80,135,494	H166N	probably damaging	Het
Cdr2l	T	A	11: 115,394,179	I447N	probably damaging	Het
Cped1	T	G	6: 22,215,562	I698M	probably damaging	Het
Ecm1	G	A	3: 95,735,350	H404Y	possibly damaging	Het
Ehbp1	C	T	11: 22,062,831	V902I	probably benign	Het
Eps8	T	C	6: 137,522,854	Q209R	possibly damaging	Het
Fastk	C	T	5: 24,441,731		probably null	Het
Gm6797	T	A	X: 8,641,765		noncoding transcript	Het
Gp1ba	C	T	11: 70,641,427	P673L	probably damaging	Het
Gstm1	A	G	3: 108,014,811	F170S	probably damaging	Het
Hgf	G	C	5: 16,618,925	G707R	probably damaging	Het
Klhl5	T	C	5: 65,162,885	M594T	probably damaging	Het
Kyat3	A	C	3: 142,737,770		probably null	Het
Mettl14	C	T	3: 123,374,002	G236S	probably damaging	Het
Nob1	G	A	8: 107,421,490	P107S	probably damaging	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr1155	G	A	2: 87,943,146	L161F	probably benign	Het
Olfr1463	C	A	19: 13,234,831	H194N	probably benign	Het
Olfr444	T	A	6: 42,955,558	L20Q	probably benign	Het
Olfr503	C	A	7: 108,545,302	T257N	probably benign	Het
Olfr676	T	A	7: 105,035,814	N205K	probably damaging	Het
Olfr808	A	G	10: 129,768,164	I223V	probably benign	Het
Pald1	A	G	10: 61,347,587		probably benign	Het
Pds5a	A	T	5: 65,627,202		probably null	Het
Plekha2	A	C	8: 25,059,202	S189A	probably benign	Het
Prune2	T	C	19: 17,123,105	V1991A	probably benign	Het
Sec61g	A	C	11: 16,504,722		probably benign	Het
Serinc3	T	C	2: 163,625,526	K445R	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slfn8	T	C	11: 83,016,745	E324G	probably benign	Het
Spink13	A	G	18: 62,608,170		probably benign	Het
Tas2r121	A	T	6: 132,700,169	I280N	probably damaging	Het
Tbc1d7	T	C	13: 43,153,139	I242M	probably damaging	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tnni3k	A	T	3: 154,875,513	H600Q	probably damaging	Het
Trim66	C	T	7: 109,484,577		probably null	Het
Ttn	A	T	2: 76,969,703	I387N	probably damaging	Het
Tulp3	A	T	6: 128,325,952	H301Q	possibly damaging	Het
Ubqln5	T	A	7: 104,128,741	Q292L	probably damaging	Het
Zfp454	T	C	11: 50,873,586	K229E	probably damaging	Het

Other mutations in Pirb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Pirb	APN	7	3717406	missense	probably damaging	0.99
IGL01744:Pirb	APN	7	3717176	nonsense	probably null
IGL01755:Pirb	APN	7	3717170	missense	probably benign	0.16
IGL02580:Pirb	APN	7	3714206	splice site	probably null
IGL02941:Pirb	APN	7	3717378	missense	probably damaging	1.00
R0394:Pirb	UTSW	7	3719248	missense	probably benign	0.08
R0680:Pirb	UTSW	7	3717361	missense	possibly damaging	0.94
R0787:Pirb	UTSW	7	3717638	missense	probably benign
R0790:Pirb	UTSW	7	3717638	missense	probably benign
R0832:Pirb	UTSW	7	3717638	missense	probably benign
R1124:Pirb	UTSW	7	3719732	missense	probably benign	0.02
R1178:Pirb	UTSW	7	3717638	missense	probably benign
R1180:Pirb	UTSW	7	3717638	missense	probably benign
R1281:Pirb	UTSW	7	3717190	missense	probably damaging	1.00
R1343:Pirb	UTSW	7	3717638	missense	probably benign
R1579:Pirb	UTSW	7	3717638	missense	probably benign
R1699:Pirb	UTSW	7	3717638	missense	probably benign
R1768:Pirb	UTSW	7	3717190	missense	probably damaging	1.00
R1909:Pirb	UTSW	7	3714588	missense	probably benign	0.33
R1965:Pirb	UTSW	7	3717638	missense	probably benign
R1966:Pirb	UTSW	7	3717638	missense	probably benign
R2004:Pirb	UTSW	7	3717638	missense	probably benign
R2305:Pirb	UTSW	7	3712991	missense	probably benign	0.00
R2931:Pirb	UTSW	7	3717206	missense	probably benign	0.08
R3858:Pirb	UTSW	7	3717663	missense	possibly damaging	0.54
R3928:Pirb	UTSW	7	3717638	missense	probably benign
R3938:Pirb	UTSW	7	3717638	missense	probably benign
R4119:Pirb	UTSW	7	3717575	missense	probably damaging	1.00
R4174:Pirb	UTSW	7	3716032	critical splice donor site	probably null
R4248:Pirb	UTSW	7	3719298	missense	probably damaging	1.00
R4827:Pirb	UTSW	7	3717603	missense	probably benign
R4828:Pirb	UTSW	7	3717603	missense	probably benign
R4829:Pirb	UTSW	7	3717603	missense	probably benign
R4830:Pirb	UTSW	7	3717603	missense	probably benign
R4870:Pirb	UTSW	7	3712662	missense	probably benign	0.00
R4909:Pirb	UTSW	7	3719362	nonsense	probably null
R5146:Pirb	UTSW	7	3712621	utr 3 prime	probably benign
R5244:Pirb	UTSW	7	3716063	missense	probably benign	0.32
R5323:Pirb	UTSW	7	3716599	missense	possibly damaging	0.85
R5921:Pirb	UTSW	7	3716694	nonsense	probably null
R6316:Pirb	UTSW	7	3717823	missense	probably damaging	1.00
R6502:Pirb	UTSW	7	3717393	missense	probably benign	0.00
R6811:Pirb	UTSW	7	3719642	missense	possibly damaging	0.91
R7216:Pirb	UTSW	7	3716274	missense	probably benign	0.00
R7275:Pirb	UTSW	7	3716178	missense	probably benign	0.00
R7327:Pirb	UTSW	7	3717188	nonsense	probably null
R7582:Pirb	UTSW	7	3713818	critical splice donor site	probably null
R7717:Pirb	UTSW	7	3717783	missense	not run
R7717:Pirb	UTSW	7	3717801	missense	not run
R7807:Pirb	UTSW	7	3719865	missense	possibly damaging	0.55
R7844:Pirb	UTSW	7	3719411	nonsense	probably null
R7947:Pirb	UTSW	7	3719858	missense	probably damaging	0.96
R8206:Pirb	UTSW	7	3712906	critical splice donor site	probably null
R8397:Pirb	UTSW	7	3716046	missense	probably damaging	1.00
R8774:Pirb	UTSW	7	3717729	missense	probably damaging	1.00
R8774-TAIL:Pirb	UTSW	7	3717729	missense	probably damaging	1.00
X0025:Pirb	UTSW	7	3717268	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACCGTAACATCTGAATGCCCCTG -3'
(R):5'- TCTGGGCCACTTTCCAACACAC -3'

Sequencing Primer
(F):5'- TCCTATAATAAACAGGGCTCGG -3'
(R):5'- ACCATCAAGGCTGAACCAGG -3'

Posted On

2014-01-15