Incidental Mutation 'R1181:Ubqln5'
ID101574
Institutional Source Beutler Lab
Gene Symbol Ubqln5
Ensembl Gene ENSMUSG00000055643
Gene Nameubiquilin 5
Synonyms4931431F19Rik
MMRRC Submission 039253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1181 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104127912-104129826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104128741 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 292 (Q292L)
Ref Sequence ENSEMBL: ENSMUSP00000062054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053743] [ENSMUST00000138055]
PDB Structure
Solution Structure of RSGI RUH-016, a UBA Domain from mouse cDNA [SOLUTION NMR]
Solution Structure of the N-terminal Ubiquitin-like Domain in the 4931431F19Rik Protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000053743
AA Change: Q292L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062054
Gene: ENSMUSG00000055643
AA Change: Q292L

DomainStartEndE-ValueType
UBQ 24 94 7.97e-13 SMART
low complexity region 365 376 N/A INTRINSIC
UBA 468 506 2.14e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.9%
  • 10x: 93.9%
  • 20x: 84.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T A 19: 4,872,610 Q64L probably benign Het
Ankrd12 T C 17: 66,042,574 N88S probably benign Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Bnipl C A 3: 95,245,649 probably null Het
Bod1 T C 11: 31,666,943 probably benign Het
Cbarp G T 10: 80,135,494 H166N probably damaging Het
Cdr2l T A 11: 115,394,179 I447N probably damaging Het
Cped1 T G 6: 22,215,562 I698M probably damaging Het
Ecm1 G A 3: 95,735,350 H404Y possibly damaging Het
Ehbp1 C T 11: 22,062,831 V902I probably benign Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fastk C T 5: 24,441,731 probably null Het
Gm6797 T A X: 8,641,765 noncoding transcript Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgf G C 5: 16,618,925 G707R probably damaging Het
Klhl5 T C 5: 65,162,885 M594T probably damaging Het
Kyat3 A C 3: 142,737,770 probably null Het
Mettl14 C T 3: 123,374,002 G236S probably damaging Het
Nob1 G A 8: 107,421,490 P107S probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr1463 C A 19: 13,234,831 H194N probably benign Het
Olfr444 T A 6: 42,955,558 L20Q probably benign Het
Olfr503 C A 7: 108,545,302 T257N probably benign Het
Olfr676 T A 7: 105,035,814 N205K probably damaging Het
Olfr808 A G 10: 129,768,164 I223V probably benign Het
Pald1 A G 10: 61,347,587 probably benign Het
Pds5a A T 5: 65,627,202 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekha2 A C 8: 25,059,202 S189A probably benign Het
Prune2 T C 19: 17,123,105 V1991A probably benign Het
Sec61g A C 11: 16,504,722 probably benign Het
Serinc3 T C 2: 163,625,526 K445R probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slfn8 T C 11: 83,016,745 E324G probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tas2r121 A T 6: 132,700,169 I280N probably damaging Het
Tbc1d7 T C 13: 43,153,139 I242M probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Trim66 C T 7: 109,484,577 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Tulp3 A T 6: 128,325,952 H301Q possibly damaging Het
Zfp454 T C 11: 50,873,586 K229E probably damaging Het
Other mutations in Ubqln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Ubqln5 APN 7 104128427 missense possibly damaging 0.83
IGL02127:Ubqln5 APN 7 104129482 missense probably damaging 0.99
IGL02565:Ubqln5 APN 7 104129072 nonsense probably null
R1962:Ubqln5 UTSW 7 104128888 missense possibly damaging 0.83
R1962:Ubqln5 UTSW 7 104128927 missense probably damaging 0.98
R1964:Ubqln5 UTSW 7 104128888 missense possibly damaging 0.83
R1992:Ubqln5 UTSW 7 104129534 missense probably damaging 1.00
R1998:Ubqln5 UTSW 7 104128741 missense probably damaging 0.99
R3927:Ubqln5 UTSW 7 104128471 missense probably damaging 1.00
R4831:Ubqln5 UTSW 7 104129622 intron probably benign
R5699:Ubqln5 UTSW 7 104129425 missense possibly damaging 0.78
R5840:Ubqln5 UTSW 7 104128954 missense possibly damaging 0.83
R5858:Ubqln5 UTSW 7 104128811 missense probably benign 0.17
R5907:Ubqln5 UTSW 7 104128574 missense possibly damaging 0.55
R6477:Ubqln5 UTSW 7 104128258 missense probably damaging 0.97
R6602:Ubqln5 UTSW 7 104129489 missense probably benign 0.07
R6919:Ubqln5 UTSW 7 104129008 missense probably benign 0.15
R6981:Ubqln5 UTSW 7 104128601 missense probably benign 0.29
R8153:Ubqln5 UTSW 7 104128804 missense possibly damaging 0.52
X0028:Ubqln5 UTSW 7 104129408 missense probably damaging 1.00
Z1088:Ubqln5 UTSW 7 104128971 missense possibly damaging 0.83
Z1176:Ubqln5 UTSW 7 104128918 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGCCAACTGATGTGCCAGAGATG -3'
(R):5'- GCAGGAAGTTCTCCAGGAACACAAG -3'

Sequencing Primer
(F):5'- CCAGAGATGGATTCTGCTGC -3'
(R):5'- GGTGACAACGCTATGCATCC -3'
Posted On2014-01-15