Incidental Mutation 'R1181:Zfp454'
ID101597
Institutional Source Beutler Lab
Gene Symbol Zfp454
Ensembl Gene ENSMUSG00000048728
Gene Namezinc finger protein 454
Synonyms
MMRRC Submission 039253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1181 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50872720-50887651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50873586 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 229 (K229E)
Ref Sequence ENSEMBL: ENSMUSP00000104759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050595] [ENSMUST00000109131] [ENSMUST00000125749] [ENSMUST00000163301]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050595
AA Change: K340E

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061824
Gene: ENSMUSG00000048728
AA Change: K340E

DomainStartEndE-ValueType
KRAB 14 75 1.35e-29 SMART
ZnF_C2H2 191 213 9.73e-4 SMART
ZnF_C2H2 230 252 6.32e-3 SMART
ZnF_C2H2 258 280 2.4e-3 SMART
ZnF_C2H2 286 308 8.22e-2 SMART
ZnF_C2H2 314 336 1.33e-1 SMART
ZnF_C2H2 342 364 1.84e-4 SMART
ZnF_C2H2 370 392 9.73e-4 SMART
ZnF_C2H2 398 420 5.21e-4 SMART
ZnF_C2H2 426 448 4.87e-4 SMART
ZnF_C2H2 454 476 2.12e-4 SMART
ZnF_C2H2 482 504 1.04e-3 SMART
ZnF_C2H2 510 532 2.95e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109131
AA Change: K229E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104759
Gene: ENSMUSG00000048728
AA Change: K229E

DomainStartEndE-ValueType
ZnF_C2H2 80 102 9.73e-4 SMART
ZnF_C2H2 119 141 6.32e-3 SMART
ZnF_C2H2 147 169 2.4e-3 SMART
ZnF_C2H2 175 197 8.22e-2 SMART
ZnF_C2H2 203 225 1.33e-1 SMART
ZnF_C2H2 231 253 1.84e-4 SMART
ZnF_C2H2 259 281 9.73e-4 SMART
ZnF_C2H2 287 309 5.21e-4 SMART
ZnF_C2H2 315 337 4.87e-4 SMART
ZnF_C2H2 343 365 2.12e-4 SMART
ZnF_C2H2 371 393 1.04e-3 SMART
ZnF_C2H2 399 421 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125749
SMART Domains Protein: ENSMUSP00000122658
Gene: ENSMUSG00000048728

DomainStartEndE-ValueType
KRAB 14 75 1.35e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136599
Predicted Effect possibly damaging
Transcript: ENSMUST00000163301
AA Change: K340E

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129125
Gene: ENSMUSG00000048728
AA Change: K340E

DomainStartEndE-ValueType
KRAB 14 75 1.35e-29 SMART
ZnF_C2H2 191 213 9.73e-4 SMART
ZnF_C2H2 230 252 6.32e-3 SMART
ZnF_C2H2 258 280 2.4e-3 SMART
ZnF_C2H2 286 308 8.22e-2 SMART
ZnF_C2H2 314 336 1.33e-1 SMART
ZnF_C2H2 342 364 1.84e-4 SMART
ZnF_C2H2 370 392 9.73e-4 SMART
ZnF_C2H2 398 420 5.21e-4 SMART
ZnF_C2H2 426 448 4.87e-4 SMART
ZnF_C2H2 454 476 2.12e-4 SMART
ZnF_C2H2 482 504 1.04e-3 SMART
ZnF_C2H2 510 532 2.95e-3 SMART
Meta Mutation Damage Score 0.2929 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.9%
  • 10x: 93.9%
  • 20x: 84.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T A 19: 4,872,610 Q64L probably benign Het
Ankrd12 T C 17: 66,042,574 N88S probably benign Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Bnipl C A 3: 95,245,649 probably null Het
Bod1 T C 11: 31,666,943 probably benign Het
Cbarp G T 10: 80,135,494 H166N probably damaging Het
Cdr2l T A 11: 115,394,179 I447N probably damaging Het
Cped1 T G 6: 22,215,562 I698M probably damaging Het
Ecm1 G A 3: 95,735,350 H404Y possibly damaging Het
Ehbp1 C T 11: 22,062,831 V902I probably benign Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fastk C T 5: 24,441,731 probably null Het
Gm6797 T A X: 8,641,765 noncoding transcript Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgf G C 5: 16,618,925 G707R probably damaging Het
Klhl5 T C 5: 65,162,885 M594T probably damaging Het
Kyat3 A C 3: 142,737,770 probably null Het
Mettl14 C T 3: 123,374,002 G236S probably damaging Het
Nob1 G A 8: 107,421,490 P107S probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr1463 C A 19: 13,234,831 H194N probably benign Het
Olfr444 T A 6: 42,955,558 L20Q probably benign Het
Olfr503 C A 7: 108,545,302 T257N probably benign Het
Olfr676 T A 7: 105,035,814 N205K probably damaging Het
Olfr808 A G 10: 129,768,164 I223V probably benign Het
Pald1 A G 10: 61,347,587 probably benign Het
Pds5a A T 5: 65,627,202 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekha2 A C 8: 25,059,202 S189A probably benign Het
Prune2 T C 19: 17,123,105 V1991A probably benign Het
Sec61g A C 11: 16,504,722 probably benign Het
Serinc3 T C 2: 163,625,526 K445R probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slfn8 T C 11: 83,016,745 E324G probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tas2r121 A T 6: 132,700,169 I280N probably damaging Het
Tbc1d7 T C 13: 43,153,139 I242M probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Trim66 C T 7: 109,484,577 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Tulp3 A T 6: 128,325,952 H301Q possibly damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Other mutations in Zfp454
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Zfp454 APN 11 50874206 missense probably benign 0.22
IGL01631:Zfp454 APN 11 50883735 missense probably benign
R0109:Zfp454 UTSW 11 50883775 missense possibly damaging 0.71
R0606:Zfp454 UTSW 11 50874185 missense probably benign 0.00
R0743:Zfp454 UTSW 11 50873937 missense probably benign 0.01
R0884:Zfp454 UTSW 11 50873937 missense probably benign 0.01
R1377:Zfp454 UTSW 11 50873780 missense probably damaging 1.00
R2126:Zfp454 UTSW 11 50873995 missense probably benign 0.44
R4869:Zfp454 UTSW 11 50873153 missense probably damaging 1.00
R4973:Zfp454 UTSW 11 50874123 missense probably benign
R5379:Zfp454 UTSW 11 50883802 missense probably damaging 0.99
R5997:Zfp454 UTSW 11 50873622 missense probably damaging 1.00
R6321:Zfp454 UTSW 11 50873049 missense probably damaging 0.98
R6490:Zfp454 UTSW 11 50874123 missense probably benign
R6892:Zfp454 UTSW 11 50873198 missense probably damaging 1.00
R7362:Zfp454 UTSW 11 50886367 critical splice donor site probably null
R7650:Zfp454 UTSW 11 50883753 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTGTGATGCCTCTGGTGCTGA -3'
(R):5'- CCAGTGCAAGGACTGTGGCAA -3'

Sequencing Primer
(F):5'- ccctgaaagccttctcacac -3'
(R):5'- accagaaaatccataccggag -3'
Posted On2014-01-15