Incidental Mutation 'R1181:Slfn8'
ID 101601
Institutional Source Beutler Lab
Gene Symbol Slfn8
Ensembl Gene ENSMUSG00000035208
Gene Name schlafen 8
Synonyms
MMRRC Submission 039253-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R1181 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 83002158-83020810 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83016745 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 324 (E324G)
Ref Sequence ENSEMBL: ENSMUSP00000149800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]
AlphaFold B1ARD8
Predicted Effect probably benign
Transcript: ENSMUST00000038141
AA Change: E324G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: E324G

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 1.6e-18 PFAM
Pfam:DUF2075 592 766 5.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092838
AA Change: E324G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: E324G

DomainStartEndE-ValueType
Pfam:AlbA_2 205 341 1.4e-17 PFAM
Pfam:DUF2075 592 767 2.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108152
AA Change: E324G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208
AA Change: E324G

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130822
AA Change: E324G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: E324G

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 3.7e-19 PFAM
SCOP:d1ly1a_ 593 625 4e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131883
AA Change: E145G
SMART Domains Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208
AA Change: E145G

DomainStartEndE-ValueType
Pfam:AlbA_2 27 163 1.8e-15 PFAM
SCOP:d1ly1a_ 370 402 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215239
AA Change: E324G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.9%
  • 10x: 93.9%
  • 20x: 84.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T A 19: 4,872,610 (GRCm38) Q64L probably benign Het
Ankrd12 T C 17: 66,042,574 (GRCm38) N88S probably benign Het
Apcdd1 A T 18: 62,937,097 (GRCm38) Y145F probably damaging Het
Bnipl C A 3: 95,245,649 (GRCm38) probably null Het
Bod1 T C 11: 31,666,943 (GRCm38) probably benign Het
Cbarp G T 10: 80,135,494 (GRCm38) H166N probably damaging Het
Cdr2l T A 11: 115,394,179 (GRCm38) I447N probably damaging Het
Cped1 T G 6: 22,215,562 (GRCm38) I698M probably damaging Het
Ecm1 G A 3: 95,735,350 (GRCm38) H404Y possibly damaging Het
Ehbp1 C T 11: 22,062,831 (GRCm38) V902I probably benign Het
Eps8 T C 6: 137,522,854 (GRCm38) Q209R possibly damaging Het
Fastk C T 5: 24,441,731 (GRCm38) probably null Het
Gm6797 T A X: 8,641,765 (GRCm38) noncoding transcript Het
Gp1ba C T 11: 70,641,427 (GRCm38) P673L probably damaging Het
Gstm1 A G 3: 108,014,811 (GRCm38) F170S probably damaging Het
Hgf G C 5: 16,618,925 (GRCm38) G707R probably damaging Het
Klhl5 T C 5: 65,162,885 (GRCm38) M594T probably damaging Het
Kyat3 A C 3: 142,737,770 (GRCm38) probably null Het
Mettl14 C T 3: 123,374,002 (GRCm38) G236S probably damaging Het
Nob1 G A 8: 107,421,490 (GRCm38) P107S probably damaging Het
Nup58 A T 14: 60,244,670 (GRCm38) probably benign Het
Or2a56 T A 6: 42,955,558 (GRCm38) L20Q probably benign Het
Or52e7 T A 7: 105,035,814 (GRCm38) N205K probably damaging Het
Or52n4b C A 7: 108,545,302 (GRCm38) T257N probably benign Het
Or5b109 C A 19: 13,234,831 (GRCm38) H194N probably benign Het
Or5d16 G A 2: 87,943,146 (GRCm38) L161F probably benign Het
Or6c65 A G 10: 129,768,164 (GRCm38) I223V probably benign Het
Pald1 A G 10: 61,347,587 (GRCm38) probably benign Het
Pds5a A T 5: 65,627,202 (GRCm38) probably null Het
Pirb A T 7: 3,717,638 (GRCm38) L287Q probably benign Het
Plekha2 A C 8: 25,059,202 (GRCm38) S189A probably benign Het
Prune2 T C 19: 17,123,105 (GRCm38) V1991A probably benign Het
Sec61g A C 11: 16,504,722 (GRCm38) probably benign Het
Serinc3 T C 2: 163,625,526 (GRCm38) K445R probably damaging Het
Shf G A 2: 122,368,682 (GRCm38) P51S probably damaging Het
Spink13 A G 18: 62,608,170 (GRCm38) probably benign Het
Tas2r121 A T 6: 132,700,169 (GRCm38) I280N probably damaging Het
Tbc1d7 T C 13: 43,153,139 (GRCm38) I242M probably damaging Het
Tenm2 C T 11: 36,063,177 (GRCm38) G1236R possibly damaging Het
Tnni3k A T 3: 154,875,513 (GRCm38) H600Q probably damaging Het
Trim66 C T 7: 109,484,577 (GRCm38) probably null Het
Ttn A T 2: 76,969,703 (GRCm38) I387N probably damaging Het
Tulp3 A T 6: 128,325,952 (GRCm38) H301Q possibly damaging Het
Ubqln5 T A 7: 104,128,741 (GRCm38) Q292L probably damaging Het
Zfp454 T C 11: 50,873,586 (GRCm38) K229E probably damaging Het
Other mutations in Slfn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Slfn8 APN 11 83,013,484 (GRCm38) missense possibly damaging 0.75
IGL01418:Slfn8 APN 11 83,004,636 (GRCm38) missense probably damaging 1.00
IGL01620:Slfn8 APN 11 83,004,233 (GRCm38) nonsense probably null
IGL01875:Slfn8 APN 11 83,004,079 (GRCm38) missense probably benign 0.30
IGL01896:Slfn8 APN 11 83,003,696 (GRCm38) missense probably damaging 1.00
IGL01929:Slfn8 APN 11 83,003,405 (GRCm38) nonsense probably null
IGL02111:Slfn8 APN 11 83,004,498 (GRCm38) missense probably damaging 1.00
IGL02136:Slfn8 APN 11 83,003,465 (GRCm38) nonsense probably null
IGL02165:Slfn8 APN 11 83,017,196 (GRCm38) missense probably benign 0.00
IGL02645:Slfn8 APN 11 83,003,554 (GRCm38) missense possibly damaging 0.82
IGL02682:Slfn8 APN 11 83,003,691 (GRCm38) missense probably damaging 1.00
IGL02689:Slfn8 APN 11 83,017,108 (GRCm38) missense probably damaging 1.00
IGL02948:Slfn8 APN 11 83,003,252 (GRCm38) missense probably damaging 0.99
IGL03037:Slfn8 APN 11 83,003,252 (GRCm38) missense probably damaging 0.99
IGL03185:Slfn8 APN 11 83,017,507 (GRCm38) missense probably benign 0.01
IGL03243:Slfn8 APN 11 83,003,707 (GRCm38) missense probably damaging 1.00
IGL03286:Slfn8 APN 11 83,013,468 (GRCm38) missense probably damaging 0.99
seven_dwarfs UTSW 11 83,003,334 (GRCm38) missense probably benign 0.09
vanwinkle UTSW 11 83,017,393 (GRCm38) missense probably damaging 1.00
R0295:Slfn8 UTSW 11 83,003,343 (GRCm38) nonsense probably null
R0368:Slfn8 UTSW 11 83,017,132 (GRCm38) missense probably damaging 1.00
R0382:Slfn8 UTSW 11 83,004,556 (GRCm38) missense probably damaging 1.00
R0655:Slfn8 UTSW 11 83,003,821 (GRCm38) missense probably benign 0.35
R0894:Slfn8 UTSW 11 83,003,581 (GRCm38) missense probably benign 0.07
R1006:Slfn8 UTSW 11 83,003,511 (GRCm38) missense possibly damaging 0.69
R1187:Slfn8 UTSW 11 83,003,488 (GRCm38) missense probably damaging 1.00
R1501:Slfn8 UTSW 11 83,003,180 (GRCm38) missense probably damaging 0.99
R1646:Slfn8 UTSW 11 83,016,886 (GRCm38) missense probably damaging 1.00
R1909:Slfn8 UTSW 11 83,003,621 (GRCm38) nonsense probably null
R2005:Slfn8 UTSW 11 83,004,150 (GRCm38) missense probably damaging 1.00
R2363:Slfn8 UTSW 11 83,004,094 (GRCm38) missense probably damaging 1.00
R3780:Slfn8 UTSW 11 83,017,454 (GRCm38) missense probably benign 0.13
R3890:Slfn8 UTSW 11 83,004,444 (GRCm38) missense possibly damaging 0.68
R3917:Slfn8 UTSW 11 83,016,993 (GRCm38) nonsense probably null
R4559:Slfn8 UTSW 11 83,004,744 (GRCm38) missense probably damaging 1.00
R4684:Slfn8 UTSW 11 83,017,506 (GRCm38) missense probably benign 0.10
R4767:Slfn8 UTSW 11 83,003,197 (GRCm38) missense possibly damaging 0.66
R4773:Slfn8 UTSW 11 83,017,393 (GRCm38) missense probably damaging 1.00
R4859:Slfn8 UTSW 11 83,017,714 (GRCm38) start codon destroyed probably null 0.99
R4916:Slfn8 UTSW 11 83,016,878 (GRCm38) missense probably damaging 1.00
R4939:Slfn8 UTSW 11 83,003,285 (GRCm38) missense probably benign 0.01
R5107:Slfn8 UTSW 11 83,017,150 (GRCm38) missense probably damaging 0.99
R5130:Slfn8 UTSW 11 83,003,821 (GRCm38) missense probably benign 0.35
R5165:Slfn8 UTSW 11 83,017,127 (GRCm38) missense probably damaging 0.99
R5238:Slfn8 UTSW 11 83,013,388 (GRCm38) missense probably damaging 0.96
R5282:Slfn8 UTSW 11 83,017,724 (GRCm38) critical splice acceptor site probably null
R5311:Slfn8 UTSW 11 83,004,084 (GRCm38) missense probably damaging 1.00
R5499:Slfn8 UTSW 11 83,004,216 (GRCm38) missense probably damaging 0.99
R5617:Slfn8 UTSW 11 83,004,721 (GRCm38) missense probably benign 0.01
R5782:Slfn8 UTSW 11 83,017,041 (GRCm38) missense probably damaging 0.98
R5823:Slfn8 UTSW 11 83,016,736 (GRCm38) missense probably benign 0.01
R5886:Slfn8 UTSW 11 83,003,334 (GRCm38) missense probably benign 0.09
R5933:Slfn8 UTSW 11 83,003,335 (GRCm38) missense probably benign 0.00
R6151:Slfn8 UTSW 11 83,017,321 (GRCm38) missense probably damaging 1.00
R6163:Slfn8 UTSW 11 83,003,864 (GRCm38) makesense probably null
R6191:Slfn8 UTSW 11 83,016,800 (GRCm38) missense possibly damaging 0.72
R6419:Slfn8 UTSW 11 83,004,055 (GRCm38) splice site probably null
R6925:Slfn8 UTSW 11 83,013,417 (GRCm38) nonsense probably null
R7065:Slfn8 UTSW 11 83,016,968 (GRCm38) missense probably benign 0.01
R7380:Slfn8 UTSW 11 83,003,740 (GRCm38) missense not run
R7414:Slfn8 UTSW 11 83,016,792 (GRCm38) nonsense probably null
R7819:Slfn8 UTSW 11 83,004,255 (GRCm38) missense probably damaging 1.00
R8425:Slfn8 UTSW 11 83,004,615 (GRCm38) missense possibly damaging 0.80
R8517:Slfn8 UTSW 11 83,004,142 (GRCm38) missense possibly damaging 0.68
R8804:Slfn8 UTSW 11 83,016,813 (GRCm38) missense possibly damaging 0.94
R8814:Slfn8 UTSW 11 83,016,679 (GRCm38) missense possibly damaging 0.95
R9069:Slfn8 UTSW 11 83,017,076 (GRCm38) missense probably damaging 1.00
R9233:Slfn8 UTSW 11 83,003,596 (GRCm38) missense probably damaging 1.00
R9457:Slfn8 UTSW 11 83,017,706 (GRCm38) missense probably benign
R9678:Slfn8 UTSW 11 83,016,897 (GRCm38) missense probably damaging 1.00
R9708:Slfn8 UTSW 11 83,003,441 (GRCm38) missense probably benign 0.00
R9764:Slfn8 UTSW 11 83,017,012 (GRCm38) missense probably damaging 1.00
X0021:Slfn8 UTSW 11 83,016,928 (GRCm38) missense possibly damaging 0.69
Z1177:Slfn8 UTSW 11 83,003,533 (GRCm38) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCCAACTTCAGTGGGTGTAATGAAC -3'
(R):5'- TCCGAGAGCCATGTGTCAGAACAG -3'

Sequencing Primer
(F):5'- GGGTGTAATGAACTCAGATTTCCAG -3'
(R):5'- CATGTGTCAGAACAGCCTTG -3'
Posted On 2014-01-15