Incidental Mutation 'R1181:Nupl1'
ID101607
Institutional Source Beutler Lab
Gene Symbol Nupl1
Ensembl Gene ENSMUSG00000063895
Gene Namenucleoporin like 1
Synonyms1700017F11Rik
MMRRC Submission 039253-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R1181 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location60184612-60251431 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 60244670 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041905] [ENSMUST00000225111] [ENSMUST00000225311] [ENSMUST00000225805]
Predicted Effect probably benign
Transcript: ENSMUST00000041905
SMART Domains Protein: ENSMUSP00000038716
Gene: ENSMUSG00000114797

DomainStartEndE-ValueType
Pfam:Nucleoporin_FG2 3 587 1.5e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224575
Predicted Effect probably benign
Transcript: ENSMUST00000225111
Predicted Effect probably benign
Transcript: ENSMUST00000225311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225572
Predicted Effect probably benign
Transcript: ENSMUST00000225805
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.9%
  • 10x: 93.9%
  • 20x: 84.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family that shares 87% sequence identity with rat nucleoporin p58. The protein is localized to the nuclear rim and is a component of the nuclear pore complex (NPC). All molecules entering or leaving the nucleus either diffuse through or are actively transported by the NPC. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T A 19: 4,872,610 Q64L probably benign Het
Ankrd12 T C 17: 66,042,574 N88S probably benign Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Bnipl C A 3: 95,245,649 probably null Het
Bod1 T C 11: 31,666,943 probably benign Het
Cbarp G T 10: 80,135,494 H166N probably damaging Het
Cdr2l T A 11: 115,394,179 I447N probably damaging Het
Cped1 T G 6: 22,215,562 I698M probably damaging Het
Ecm1 G A 3: 95,735,350 H404Y possibly damaging Het
Ehbp1 C T 11: 22,062,831 V902I probably benign Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fastk C T 5: 24,441,731 probably null Het
Gm6797 T A X: 8,641,765 noncoding transcript Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgf G C 5: 16,618,925 G707R probably damaging Het
Klhl5 T C 5: 65,162,885 M594T probably damaging Het
Kyat3 A C 3: 142,737,770 probably null Het
Mettl14 C T 3: 123,374,002 G236S probably damaging Het
Nob1 G A 8: 107,421,490 P107S probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr1463 C A 19: 13,234,831 H194N probably benign Het
Olfr444 T A 6: 42,955,558 L20Q probably benign Het
Olfr503 C A 7: 108,545,302 T257N probably benign Het
Olfr676 T A 7: 105,035,814 N205K probably damaging Het
Olfr808 A G 10: 129,768,164 I223V probably benign Het
Pald1 A G 10: 61,347,587 probably benign Het
Pds5a A T 5: 65,627,202 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekha2 A C 8: 25,059,202 S189A probably benign Het
Prune2 T C 19: 17,123,105 V1991A probably benign Het
Sec61g A C 11: 16,504,722 probably benign Het
Serinc3 T C 2: 163,625,526 K445R probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slfn8 T C 11: 83,016,745 E324G probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tas2r121 A T 6: 132,700,169 I280N probably damaging Het
Tbc1d7 T C 13: 43,153,139 I242M probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Trim66 C T 7: 109,484,577 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Tulp3 A T 6: 128,325,952 H301Q possibly damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Zfp454 T C 11: 50,873,586 K229E probably damaging Het
Other mutations in Nupl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nupl1 APN 14 60242577 missense probably benign 0.01
IGL00693:Nupl1 APN 14 60238520 missense probably benign 0.10
IGL00725:Nupl1 APN 14 60243440 missense possibly damaging 0.84
IGL00969:Nupl1 APN 14 60228916 splice site probably benign
IGL03243:Nupl1 APN 14 60221616 missense probably benign 0.06
IGL03351:Nupl1 APN 14 60228775 missense probably benign 0.19
R0056:Nupl1 UTSW 14 60239475 splice site probably null
R0113:Nupl1 UTSW 14 60251291 start gained probably benign
R0201:Nupl1 UTSW 14 60244616 missense probably benign 0.32
R0830:Nupl1 UTSW 14 60243482 missense probably damaging 1.00
R0925:Nupl1 UTSW 14 60220141 missense probably damaging 0.99
R1004:Nupl1 UTSW 14 60247481 splice site probably benign
R1178:Nupl1 UTSW 14 60244670 splice site probably benign
R1268:Nupl1 UTSW 14 60244670 splice site probably benign
R1388:Nupl1 UTSW 14 60244670 splice site probably benign
R1411:Nupl1 UTSW 14 60244670 splice site probably benign
R1442:Nupl1 UTSW 14 60232543 splice site probably benign
R1626:Nupl1 UTSW 14 60242627 nonsense probably null
R1697:Nupl1 UTSW 14 60244670 splice site probably benign
R1756:Nupl1 UTSW 14 60244670 splice site probably benign
R1853:Nupl1 UTSW 14 60244547 missense possibly damaging 0.81
R1915:Nupl1 UTSW 14 60238531 missense probably benign 0.00
R2160:Nupl1 UTSW 14 60239508 missense probably benign 0.15
R2211:Nupl1 UTSW 14 60232640 missense probably damaging 0.99
R2213:Nupl1 UTSW 14 60239496 missense probably benign 0.01
R2518:Nupl1 UTSW 14 60232660 missense probably damaging 1.00
R2519:Nupl1 UTSW 14 60223359 missense probably benign 0.23
R3914:Nupl1 UTSW 14 60232147 missense possibly damaging 0.76
R4302:Nupl1 UTSW 14 60247426 missense probably benign 0.44
R4626:Nupl1 UTSW 14 60238555 missense probably benign 0.24
R4705:Nupl1 UTSW 14 60251215 missense unknown
R4772:Nupl1 UTSW 14 60220022 missense probably benign 0.00
R6151:Nupl1 UTSW 14 60244616 missense possibly damaging 0.71
R6187:Nupl1 UTSW 14 60240807 splice site probably null
R6546:Nupl1 UTSW 14 60223223 intron probably null
Predicted Primers PCR Primer
(F):5'- CTGTCTCACCTGCTGGAGTTGATG -3'
(R):5'- GGGAATAAGTGCTACTGTACGAAAGCC -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGATGAGAGAGTAAG -3'
(R):5'- gcttagcattcagagattgcc -3'
Posted On2014-01-15