Incidental Mutation 'R1181:Ankrd12'
ID101609
Institutional Source Beutler Lab
Gene Symbol Ankrd12
Ensembl Gene ENSMUSG00000034647
Gene Nameankyrin repeat domain 12
Synonyms2900001A12Rik, GAC-1, ANCO-2
MMRRC Submission 039253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R1181 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location65967501-66077089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66042574 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 88 (N88S)
Ref Sequence ENSEMBL: ENSMUSP00000039035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038116] [ENSMUST00000150766]
Predicted Effect probably benign
Transcript: ENSMUST00000038116
AA Change: N88S

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039035
Gene: ENSMUSG00000034647
AA Change: N88S

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
ANK 184 213 8.78e-6 SMART
ANK 217 246 1.76e-5 SMART
ANK 250 279 7.64e-6 SMART
low complexity region 292 300 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
coiled coil region 459 497 N/A INTRINSIC
coiled coil region 639 676 N/A INTRINSIC
coiled coil region 725 752 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 933 951 N/A INTRINSIC
low complexity region 999 1018 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
low complexity region 1182 1197 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143516
Predicted Effect probably benign
Transcript: ENSMUST00000150766
SMART Domains Protein: ENSMUSP00000114237
Gene: ENSMUSG00000034647

DomainStartEndE-ValueType
low complexity region 78 98 N/A INTRINSIC
ANK 161 190 8.78e-6 SMART
ANK 194 223 1.76e-5 SMART
ANK 227 256 7.64e-6 SMART
low complexity region 269 277 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
Meta Mutation Damage Score 0.0678 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.9%
  • 10x: 93.9%
  • 20x: 84.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ankyrin repeats-containing cofactor family. These proteins may inhibit the transcriptional activity of nuclear receptors through the recruitment of histone deacetylases. The encoded protein interacts with p160 coactivators and also represses transcription mediated by the coactivator alteration/deficiency in activation 3 (ADA3). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T A 19: 4,872,610 Q64L probably benign Het
Apcdd1 A T 18: 62,937,097 Y145F probably damaging Het
Bnipl C A 3: 95,245,649 probably null Het
Bod1 T C 11: 31,666,943 probably benign Het
Cbarp G T 10: 80,135,494 H166N probably damaging Het
Cdr2l T A 11: 115,394,179 I447N probably damaging Het
Cped1 T G 6: 22,215,562 I698M probably damaging Het
Ecm1 G A 3: 95,735,350 H404Y possibly damaging Het
Ehbp1 C T 11: 22,062,831 V902I probably benign Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fastk C T 5: 24,441,731 probably null Het
Gm6797 T A X: 8,641,765 noncoding transcript Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgf G C 5: 16,618,925 G707R probably damaging Het
Klhl5 T C 5: 65,162,885 M594T probably damaging Het
Kyat3 A C 3: 142,737,770 probably null Het
Mettl14 C T 3: 123,374,002 G236S probably damaging Het
Nob1 G A 8: 107,421,490 P107S probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr1463 C A 19: 13,234,831 H194N probably benign Het
Olfr444 T A 6: 42,955,558 L20Q probably benign Het
Olfr503 C A 7: 108,545,302 T257N probably benign Het
Olfr676 T A 7: 105,035,814 N205K probably damaging Het
Olfr808 A G 10: 129,768,164 I223V probably benign Het
Pald1 A G 10: 61,347,587 probably benign Het
Pds5a A T 5: 65,627,202 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekha2 A C 8: 25,059,202 S189A probably benign Het
Prune2 T C 19: 17,123,105 V1991A probably benign Het
Sec61g A C 11: 16,504,722 probably benign Het
Serinc3 T C 2: 163,625,526 K445R probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slfn8 T C 11: 83,016,745 E324G probably benign Het
Spink13 A G 18: 62,608,170 probably benign Het
Tas2r121 A T 6: 132,700,169 I280N probably damaging Het
Tbc1d7 T C 13: 43,153,139 I242M probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tnni3k A T 3: 154,875,513 H600Q probably damaging Het
Trim66 C T 7: 109,484,577 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Tulp3 A T 6: 128,325,952 H301Q possibly damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Zfp454 T C 11: 50,873,586 K229E probably damaging Het
Other mutations in Ankrd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ankrd12 APN 17 65986174 missense probably benign
IGL00555:Ankrd12 APN 17 65984976 missense probably benign 0.09
IGL00790:Ankrd12 APN 17 65984180 missense probably benign
IGL00808:Ankrd12 APN 17 65983965 missense probably benign 0.03
IGL01355:Ankrd12 APN 17 65970340 splice site probably benign
IGL01707:Ankrd12 APN 17 65984278 missense probably damaging 0.98
IGL02045:Ankrd12 APN 17 65986249 missense probably benign 0.17
IGL02125:Ankrd12 APN 17 65970144 utr 3 prime probably benign
IGL02292:Ankrd12 APN 17 66042587 missense probably damaging 0.99
IGL02376:Ankrd12 APN 17 66042529 intron probably benign
IGL02435:Ankrd12 APN 17 65987156 missense probably damaging 1.00
IGL02530:Ankrd12 APN 17 65984403 missense probably benign 0.20
R0048:Ankrd12 UTSW 17 65984803 missense probably damaging 1.00
R0048:Ankrd12 UTSW 17 65984803 missense probably damaging 1.00
R0094:Ankrd12 UTSW 17 65970176 missense probably damaging 1.00
R0195:Ankrd12 UTSW 17 66049948 splice site probably null
R0227:Ankrd12 UTSW 17 65987227 missense probably benign 0.00
R0363:Ankrd12 UTSW 17 65985681 missense probably damaging 1.00
R0366:Ankrd12 UTSW 17 65984506 missense possibly damaging 0.93
R0376:Ankrd12 UTSW 17 66053009 missense probably damaging 0.98
R0470:Ankrd12 UTSW 17 65986134 missense probably benign 0.00
R0480:Ankrd12 UTSW 17 66049828 missense possibly damaging 0.47
R0538:Ankrd12 UTSW 17 66049852 missense probably damaging 1.00
R0883:Ankrd12 UTSW 17 65985132 missense probably benign 0.19
R1386:Ankrd12 UTSW 17 65983380 missense possibly damaging 0.94
R1476:Ankrd12 UTSW 17 65986305 missense probably damaging 0.99
R1574:Ankrd12 UTSW 17 65986274 missense probably benign 0.08
R1574:Ankrd12 UTSW 17 65986274 missense probably benign 0.08
R1602:Ankrd12 UTSW 17 65983688 nonsense probably null
R1728:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1729:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1784:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1795:Ankrd12 UTSW 17 65986227 missense possibly damaging 0.89
R1901:Ankrd12 UTSW 17 65986703 missense possibly damaging 0.58
R1929:Ankrd12 UTSW 17 65986686 missense possibly damaging 0.55
R1952:Ankrd12 UTSW 17 66031571 missense probably damaging 0.98
R1997:Ankrd12 UTSW 17 65984884 missense probably damaging 1.00
R2207:Ankrd12 UTSW 17 66031574 splice site probably null
R3612:Ankrd12 UTSW 17 65983547 missense probably benign 0.01
R3768:Ankrd12 UTSW 17 65985720 missense probably benign
R3909:Ankrd12 UTSW 17 65984005 missense probably benign 0.05
R3945:Ankrd12 UTSW 17 65976103 missense probably damaging 1.00
R4176:Ankrd12 UTSW 17 66027366 missense probably damaging 1.00
R4461:Ankrd12 UTSW 17 65985937 unclassified probably null
R4628:Ankrd12 UTSW 17 65985994 missense probably benign
R4726:Ankrd12 UTSW 17 65970324 missense probably damaging 1.00
R4785:Ankrd12 UTSW 17 65982999 missense probably damaging 1.00
R4828:Ankrd12 UTSW 17 65984637 missense probably damaging 0.99
R4847:Ankrd12 UTSW 17 66024092 missense probably benign 0.14
R4858:Ankrd12 UTSW 17 66031433 missense probably damaging 1.00
R5344:Ankrd12 UTSW 17 66049848 missense probably damaging 1.00
R5749:Ankrd12 UTSW 17 65986096 missense probably benign 0.02
R7132:Ankrd12 UTSW 17 65983247 missense probably benign
R7205:Ankrd12 UTSW 17 65985165 missense probably damaging 1.00
R7379:Ankrd12 UTSW 17 65985247 nonsense probably null
R7569:Ankrd12 UTSW 17 65982905 missense probably damaging 1.00
R7570:Ankrd12 UTSW 17 65985360 missense probably benign
R7783:Ankrd12 UTSW 17 66027250 critical splice donor site probably null
R7790:Ankrd12 UTSW 17 65984230 missense possibly damaging 0.71
R7808:Ankrd12 UTSW 17 65985653 missense possibly damaging 0.94
R7834:Ankrd12 UTSW 17 65987352 missense probably damaging 1.00
R7896:Ankrd12 UTSW 17 65985685 nonsense probably null
R7917:Ankrd12 UTSW 17 65987352 missense probably damaging 1.00
R7979:Ankrd12 UTSW 17 65985685 nonsense probably null
Z1176:Ankrd12 UTSW 17 65970338 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTCTCCTGTACCAAACCCAAGTGG -3'
(R):5'- GGGGACTGACATGCATAGATGCTC -3'

Sequencing Primer
(F):5'- TGTTCAGAGACACCATGTGC -3'
(R):5'- GCTGCATTTCTAAGCTTCAAGG -3'
Posted On2014-01-15