Mutagenetix > Incidental Mutations

Incidental Mutation 'R1181:Apcdd1'

101612

Institutional Source

Beutler Lab

Gene Symbol

Apcdd1

Ensembl Gene

ENSMUSG00000071847

Gene Name

adenomatosis polyposis coli down-regulated 1

Synonyms

Drapc1, EIG180

MMRRC Submission

039253-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R1181 (G1)

Quality Score

201

Status

Validated

Chromosome

Chromosomal Location

62922327-62953195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62937097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 145 (Y145F)

Ref Sequence

ENSEMBL: ENSMUSP00000125868 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]

AlphaFold

Q3U128

Predicted Effect

probably damaging
Transcript: ENSMUST00000096554
AA Change: Y145F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: Y145F

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163716
AA Change: Y145F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: Y145F

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Meta Mutation Damage Score

0.3554

Coding Region Coverage

1x: 99.3%
3x: 97.9%
10x: 93.9%
20x: 84.2%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn3	T	A	19: 4,872,610	Q64L	probably benign	Het
Ankrd12	T	C	17: 66,042,574	N88S	probably benign	Het
Bnipl	C	A	3: 95,245,649		probably null	Het
Bod1	T	C	11: 31,666,943		probably benign	Het
Cbarp	G	T	10: 80,135,494	H166N	probably damaging	Het
Cdr2l	T	A	11: 115,394,179	I447N	probably damaging	Het
Cped1	T	G	6: 22,215,562	I698M	probably damaging	Het
Ecm1	G	A	3: 95,735,350	H404Y	possibly damaging	Het
Ehbp1	C	T	11: 22,062,831	V902I	probably benign	Het
Eps8	T	C	6: 137,522,854	Q209R	possibly damaging	Het
Fastk	C	T	5: 24,441,731		probably null	Het
Gm6797	T	A	X: 8,641,765		noncoding transcript	Het
Gp1ba	C	T	11: 70,641,427	P673L	probably damaging	Het
Gstm1	A	G	3: 108,014,811	F170S	probably damaging	Het
Hgf	G	C	5: 16,618,925	G707R	probably damaging	Het
Klhl5	T	C	5: 65,162,885	M594T	probably damaging	Het
Kyat3	A	C	3: 142,737,770		probably null	Het
Mettl14	C	T	3: 123,374,002	G236S	probably damaging	Het
Nob1	G	A	8: 107,421,490	P107S	probably damaging	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr1155	G	A	2: 87,943,146	L161F	probably benign	Het
Olfr1463	C	A	19: 13,234,831	H194N	probably benign	Het
Olfr444	T	A	6: 42,955,558	L20Q	probably benign	Het
Olfr503	C	A	7: 108,545,302	T257N	probably benign	Het
Olfr676	T	A	7: 105,035,814	N205K	probably damaging	Het
Olfr808	A	G	10: 129,768,164	I223V	probably benign	Het
Pald1	A	G	10: 61,347,587		probably benign	Het
Pds5a	A	T	5: 65,627,202		probably null	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plekha2	A	C	8: 25,059,202	S189A	probably benign	Het
Prune2	T	C	19: 17,123,105	V1991A	probably benign	Het
Sec61g	A	C	11: 16,504,722		probably benign	Het
Serinc3	T	C	2: 163,625,526	K445R	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slfn8	T	C	11: 83,016,745	E324G	probably benign	Het
Spink13	A	G	18: 62,608,170		probably benign	Het
Tas2r121	A	T	6: 132,700,169	I280N	probably damaging	Het
Tbc1d7	T	C	13: 43,153,139	I242M	probably damaging	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tnni3k	A	T	3: 154,875,513	H600Q	probably damaging	Het
Trim66	C	T	7: 109,484,577		probably null	Het
Ttn	A	T	2: 76,969,703	I387N	probably damaging	Het
Tulp3	A	T	6: 128,325,952	H301Q	possibly damaging	Het
Ubqln5	T	A	7: 104,128,741	Q292L	probably damaging	Het
Zfp454	T	C	11: 50,873,586	K229E	probably damaging	Het

Other mutations in Apcdd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Apcdd1	APN	18	62933865	splice site	probably benign
IGL01522:Apcdd1	APN	18	62952115	missense	possibly damaging	0.50
IGL01637:Apcdd1	APN	18	62937286	missense	probably damaging	1.00
IGL02069:Apcdd1	APN	18	62949983	missense	probably damaging	1.00
IGL02183:Apcdd1	APN	18	62951854	missense	probably damaging	0.98
IGL02268:Apcdd1	APN	18	62950188	missense	probably damaging	0.99
IGL02664:Apcdd1	APN	18	62951820	splice site	probably benign
R0207:Apcdd1	UTSW	18	62950079	missense	probably benign	0.04
R0363:Apcdd1	UTSW	18	62937097	missense	possibly damaging	0.46
R0540:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0567:Apcdd1	UTSW	18	62934036	missense	possibly damaging	0.93
R0607:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0629:Apcdd1	UTSW	18	62933970	missense	probably damaging	1.00
R1118:Apcdd1	UTSW	18	62952024	missense	probably benign
R1178:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1180:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R4363:Apcdd1	UTSW	18	62951932	missense	possibly damaging	0.95
R5534:Apcdd1	UTSW	18	62937034	missense	probably benign	0.01
R5622:Apcdd1	UTSW	18	62936902	splice site	probably null
R5771:Apcdd1	UTSW	18	62936956	missense	probably damaging	1.00
R5852:Apcdd1	UTSW	18	62937063	missense	probably damaging	1.00
R5934:Apcdd1	UTSW	18	62951869	missense	possibly damaging	0.72
R6109:Apcdd1	UTSW	18	62937366	missense	probably damaging	1.00
R6515:Apcdd1	UTSW	18	62951839	missense	probably damaging	1.00
R6625:Apcdd1	UTSW	18	62951858	missense	probably damaging	1.00
R6831:Apcdd1	UTSW	18	62950126	nonsense	probably null
R6931:Apcdd1	UTSW	18	62933908	missense	probably damaging	1.00
R7018:Apcdd1	UTSW	18	62937049	missense	probably damaging	0.98
R7115:Apcdd1	UTSW	18	62936953	missense	probably damaging	1.00
R7148:Apcdd1	UTSW	18	62951845	missense	probably damaging	1.00
R7326:Apcdd1	UTSW	18	62952188	nonsense	probably null
R8025:Apcdd1	UTSW	18	62936908	missense	probably damaging	1.00
R8114:Apcdd1	UTSW	18	62950056	missense	probably damaging	1.00
R8261:Apcdd1	UTSW	18	62933903	missense	possibly damaging	0.86
R8404:Apcdd1	UTSW	18	62933915	missense	possibly damaging	0.66
R9015:Apcdd1	UTSW	18	62950086	missense	possibly damaging	0.93
R9040:Apcdd1	UTSW	18	62937343	missense	probably damaging	0.96
R9288:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9295:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9297:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9317:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9319:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9393:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9394:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9396:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9397:Apcdd1	UTSW	18	62922660	start gained	probably benign
X0028:Apcdd1	UTSW	18	62937130	missense	possibly damaging	0.59
Z1088:Apcdd1	UTSW	18	62937183	missense	probably benign	0.18
Z1177:Apcdd1	UTSW	18	62922691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACACGCTGTTGGCTTTATCTAGCTC -3'
(R):5'- CATGGCAAAGTTCACAGCCTTGG -3'

Sequencing Primer
(F):5'- CTGTGAAGTAAGGTCGGGTC -3'
(R):5'- TGCACTCGTGGTTACTCTC -3'

Posted On

2014-01-15