Incidental Mutation 'R1182:Vmn1r232'
ID101662
Institutional Source Beutler Lab
Gene Symbol Vmn1r232
Ensembl Gene ENSMUSG00000062165
Gene Namevomeronasal 1 receptor 232
SynonymsV1re4
MMRRC Submission 039254-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1182 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20913205-20914363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20913443 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 298 (L298F)
Ref Sequence ENSEMBL: ENSMUSP00000076261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077001]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077001
AA Change: L298F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076261
Gene: ENSMUSG00000062165
AA Change: L298F

DomainStartEndE-ValueType
Pfam:TAS2R 46 331 6.9e-7 PFAM
Pfam:7tm_1 70 324 1e-6 PFAM
Pfam:V1R 78 338 1.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232004
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 T A 8: 83,929,822 D256E probably damaging Het
Adnp G A 2: 168,184,796 A193V possibly damaging Het
Atf7ip2 T C 16: 10,241,835 L413S possibly damaging Het
Clip1 T C 5: 123,647,865 N252S probably damaging Het
Cubn A T 2: 13,445,000 N904K probably damaging Het
Draxin T C 4: 148,107,937 E306G probably damaging Het
Gabrr1 T A 4: 33,132,680 F9L probably benign Het
Hyal6 T A 6: 24,743,417 C371S probably damaging Het
Jag1 T A 2: 137,091,489 I506F probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1051 T C 2: 86,276,268 N73S probably damaging Het
Olfr675 T C 7: 105,024,078 T301A probably damaging Het
Plekhg6 C G 6: 125,372,492 E381Q probably damaging Het
Prag1 A G 8: 36,147,259 I1322V possibly damaging Het
Psmc3 T C 2: 91,056,035 I179T probably damaging Het
Rasgrp3 A G 17: 75,503,190 D295G probably benign Het
Sh3tc2 T C 18: 61,968,100 V88A probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Zfp629 C A 7: 127,610,102 C845F probably damaging Het
Other mutations in Vmn1r232
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Vmn1r232 APN 17 20914132 missense probably benign 0.07
IGL02576:Vmn1r232 APN 17 20913913 missense probably benign 0.30
H8562:Vmn1r232 UTSW 17 20913394 missense probably benign 0.29
R2010:Vmn1r232 UTSW 17 20913339 missense probably benign 0.00
R2088:Vmn1r232 UTSW 17 20913737 missense possibly damaging 0.63
R2206:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2207:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2273:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2274:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2275:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2443:Vmn1r232 UTSW 17 20913384 missense probably damaging 1.00
R2516:Vmn1r232 UTSW 17 20914026 missense possibly damaging 0.65
R3700:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R5256:Vmn1r232 UTSW 17 20913584 missense probably damaging 1.00
R5418:Vmn1r232 UTSW 17 20914116 missense possibly damaging 0.75
R5726:Vmn1r232 UTSW 17 20913339 missense probably benign 0.00
R5833:Vmn1r232 UTSW 17 20913651 missense probably damaging 1.00
R6528:Vmn1r232 UTSW 17 20914047 missense probably benign 0.12
R7019:Vmn1r232 UTSW 17 20913285 missense possibly damaging 0.76
R7600:Vmn1r232 UTSW 17 20913737 missense possibly damaging 0.63
R8377:Vmn1r232 UTSW 17 20913977 missense probably benign 0.00
Z1088:Vmn1r232 UTSW 17 20913838 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGACACCAGTGACCCAAGTGATCTC -3'
(R):5'- CTGAATTCTGCCATTCTCTAGGCCG -3'

Sequencing Primer
(F):5'- CACGACTCATCACAAATGGC -3'
(R):5'- CTCTAGGCCGTGACAAAATAGTTG -3'
Posted On2014-01-15