Mutagenetix > Incidental Mutations

Incidental Mutation 'R1183:Adamtsl2'

101673

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl2

Ensembl Gene

ENSMUSG00000036040

Gene Name

ADAMTS-like 2

Synonyms

A930008K15Rik

MMRRC Submission

039255-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1183 (G1)

Quality Score

140

Status

Not validated

Chromosome

Chromosomal Location

27079379-27108981 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27084080 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 132 (W132R)

Ref Sequence

ENSEMBL: ENSMUSP00000088774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091233]

Predicted Effect

probably damaging
Transcript: ENSMUST00000091233
AA Change: W132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: W132R

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSP1	50	106	5.14e-7	SMART
Pfam:ADAM_spacer1	214	331	5.4e-28	PFAM
low complexity region	345	358	N/A	INTRINSIC
TSP1	573	629	8.15e-1	SMART
TSP1	631	692	1.85e-2	SMART
TSP1	694	744	4.15e-1	SMART
TSP1	747	796	9.98e-5	SMART
TSP1	803	861	4.95e-2	SMART
TSP1	863	914	2.53e-6	SMART
Pfam:PLAC	922	953	1.4e-12	PFAM

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 88.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,895,303	L366Q	possibly damaging	Het
Aars	T	G	8: 111,041,574	Y192*	probably null	Het
Abcc6	T	C	7: 45,985,253	Y1100C	probably damaging	Het
Adgra2	T	A	8: 27,114,388	V497E	probably damaging	Het
Adtrp	T	G	13: 41,828,337		probably benign	Het
Alg9	T	A	9: 50,789,533	L201Q	possibly damaging	Het
Ap4e1	T	A	2: 127,014,201	I84K	probably damaging	Het
Atrnl1	T	C	19: 57,650,293	S288P	probably damaging	Het
Cacna1a	A	G	8: 84,580,217	D1367G	probably damaging	Het
Card19	C	T	13: 49,205,251	R82Q	probably damaging	Het
Cep128	T	C	12: 91,325,598	I226V	possibly damaging	Het
Ces1f	A	C	8: 93,268,005	D259E	probably benign	Het
Ckap5	T	A	2: 91,586,266	M1072K	probably benign	Het
Dcpp2	T	A	17: 23,900,494	V94D	probably benign	Het
Dnah2	T	C	11: 69,446,648	D3209G	possibly damaging	Het
Dsg1c	A	G	18: 20,283,198	T719A	probably damaging	Het
Dsp	G	A	13: 38,191,740	W1167*	probably null	Het
Eml5	T	C	12: 98,792,046	I1874V	probably benign	Het
Epg5	A	G	18: 77,960,711	T645A	probably damaging	Het
F2rl2	T	C	13: 95,701,113	L222S	probably damaging	Het
Fam114a1	T	A	5: 65,034,388	C495S	probably damaging	Het
Fbn1	A	T	2: 125,321,617	D2106E	probably benign	Het
Fgf14	T	A	14: 124,676,524	N65I	probably benign	Het
Fip1l1	T	C	5: 74,595,102	Y497H	probably damaging	Het
Fn1	A	C	1: 71,586,245	D2376E	probably damaging	Het
Foxd2	T	C	4: 114,907,465	T453A	possibly damaging	Het
Galnt1	G	T	18: 24,271,590	W328L	probably damaging	Het
Gapt	A	G	13: 110,353,838	V97A	possibly damaging	Het
Gatad1	A	G	5: 3,643,707	V154A	possibly damaging	Het
Gdf15	A	G	8: 70,631,552	F21L	probably benign	Het
Igdcc4	T	C	9: 65,121,900	F273S	possibly damaging	Het
Invs	A	T	4: 48,421,725	R786W	possibly damaging	Het
Itfg1	T	G	8: 85,780,523	E236A	probably benign	Het
Jak3	A	T	8: 71,684,550	I752F	probably damaging	Het
Kcnip3	C	A	2: 127,465,065	G144W	probably damaging	Het
Kctd19	T	C	8: 105,382,966	H925R	probably benign	Het
Kdr	C	T	5: 75,946,851	A1011T	probably damaging	Het
Kif13b	C	A	14: 64,782,377	H1398Q	probably benign	Het
Lrp4	A	T	2: 91,477,519		probably null	Het
Lrtm2	T	C	6: 119,320,885	D65G	probably benign	Het
Lyz1	A	G	10: 117,292,810	L10P	probably damaging	Het
Metap2	A	T	10: 93,870,184	N245K	probably damaging	Het
Mms19	T	C	19: 41,954,831	D297G	possibly damaging	Het
Mocs3	A	G	2: 168,231,653	D340G	possibly damaging	Het
Mtfr1l	A	G	4: 134,529,125	L243P	probably damaging	Het
Mtss1	A	G	15: 58,971,048	I105T	probably damaging	Het
Myo18a	T	C	11: 77,857,745	S1967P	probably damaging	Het
Ncor2	T	C	5: 125,023,521	N2248S	possibly damaging	Het
Nfatc2	T	C	2: 168,590,088	D35G	possibly damaging	Het
Nup210l	T	A	3: 90,159,945	M764K	probably benign	Het
Olfr519	A	G	7: 108,893,741	L222P	probably damaging	Het
Otof	T	C	5: 30,371,912	S1753G	probably damaging	Het
Otog	G	A	7: 46,289,755	V2070I	probably benign	Het
Piezo2	A	G	18: 63,086,753	V961A	probably damaging	Het
Pofut1	C	T	2: 153,261,238	S169L	probably benign	Het
Ppp1r10	T	A	17: 35,929,443	S542T	possibly damaging	Het
Prpf8	T	C	11: 75,490,330	Y219H	possibly damaging	Het
Ptges3l	T	C	11: 101,421,905	D113G	possibly damaging	Het
Pycrl	G	A	15: 75,918,798	L71F	probably benign	Het
Ramp3	A	G	11: 6,674,867	K54E	possibly damaging	Het
Rbpms	C	A	8: 33,804,072	Q214H	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Robo4	C	A	9: 37,408,052	D565E	probably damaging	Het
S100a1	C	T	3: 90,511,334	V58I	probably benign	Het
Setx	T	A	2: 29,180,092	D2636E	probably benign	Het
Sun2	A	T	15: 79,728,468	V417E	probably damaging	Het
Tbccd1	T	C	16: 22,841,769	N99S	probably benign	Het
Tex15	A	G	8: 33,574,865	D1441G	probably benign	Het
Tmc2	T	A	2: 130,247,976	M627K	probably damaging	Het
Trim32	A	G	4: 65,614,391	Y395C	probably benign	Het
Trpm2	A	G	10: 77,923,564	Y1129H	probably damaging	Het
Trpm8	A	T	1: 88,348,091	R470S	probably damaging	Het
Tsg101	G	T	7: 46,889,624	D389E	probably benign	Het
Ubn1	T	C	16: 5,064,542	L46P	probably damaging	Het
Ubr5	T	C	15: 37,997,175	I1745V	possibly damaging	Het
Usp20	T	C	2: 31,011,785	Y521H	probably benign	Het
Vmn1r159	A	T	7: 22,843,594	H4Q	probably null	Het
Vmn2r27	T	A	6: 124,200,532	E504D	probably benign	Het
Wdr72	A	T	9: 74,179,585	I612F	probably benign	Het
Zbtb8a	T	C	4: 129,357,727	H317R	possibly damaging	Het
Zfp507	T	C	7: 35,794,890	S243G	probably damaging	Het
Zfp764	A	G	7: 127,406,247	W73R	probably damaging	Het
Zmym4	A	T	4: 126,925,839	D90E	probably damaging	Het

Other mutations in Adamtsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Adamtsl2	APN	2	27085088	missense	probably damaging	1.00
IGL01902:Adamtsl2	APN	2	27087252	missense	probably damaging	1.00
IGL02207:Adamtsl2	APN	2	27102981	missense	probably damaging	0.99
IGL02247:Adamtsl2	APN	2	27084893	missense	probably damaging	1.00
IGL02253:Adamtsl2	APN	2	27098697	missense	possibly damaging	0.48
IGL02655:Adamtsl2	APN	2	27082530	splice site	probably benign
IGL03148:Adamtsl2	APN	2	27084059	missense	probably damaging	0.99
IGL03269:Adamtsl2	APN	2	27108355	nonsense	probably null
R0609:Adamtsl2	UTSW	2	27089635	missense	probably benign	0.25
R1443:Adamtsl2	UTSW	2	27103066	missense	possibly damaging	0.89
R1675:Adamtsl2	UTSW	2	27082485	frame shift	probably null
R1698:Adamtsl2	UTSW	2	27103127	missense	possibly damaging	0.92
R1765:Adamtsl2	UTSW	2	27102830	missense	probably benign	0.01
R1934:Adamtsl2	UTSW	2	27089593	missense	probably damaging	0.99
R2106:Adamtsl2	UTSW	2	27102825	missense	probably benign	0.02
R2108:Adamtsl2	UTSW	2	27095558	missense	probably benign
R2189:Adamtsl2	UTSW	2	27081738	missense	probably benign	0.00
R2232:Adamtsl2	UTSW	2	27103178	missense	probably damaging	1.00
R4301:Adamtsl2	UTSW	2	27087283	missense	probably null	1.00
R4518:Adamtsl2	UTSW	2	27095547	missense	probably benign	0.00
R4572:Adamtsl2	UTSW	2	27083256	missense	probably damaging	0.99
R4627:Adamtsl2	UTSW	2	27093585	missense	probably damaging	0.99
R4668:Adamtsl2	UTSW	2	27095475	missense	probably benign	0.00
R4686:Adamtsl2	UTSW	2	27093825	missense	probably damaging	0.99
R4821:Adamtsl2	UTSW	2	27098592	splice site	probably null
R5054:Adamtsl2	UTSW	2	27101720	missense	probably damaging	1.00
R5460:Adamtsl2	UTSW	2	27095398	splice site	probably null
R5569:Adamtsl2	UTSW	2	27102833	missense	probably damaging	1.00
R5694:Adamtsl2	UTSW	2	27081724	missense	probably benign	0.03
R6836:Adamtsl2	UTSW	2	27081706	start codon destroyed	probably null	0.90
R7103:Adamtsl2	UTSW	2	27107461	missense	probably damaging	1.00
R7437:Adamtsl2	UTSW	2	27089709	missense	probably damaging	0.99
X0003:Adamtsl2	UTSW	2	27081772	small deletion	probably benign
X0003:Adamtsl2	UTSW	2	27081773	small deletion	probably benign
Z1176:Adamtsl2	UTSW	2	27081720	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CCAAGTCTGTCTTTGTGAGCACACC -3'
(R):5'- ACAGTGGGAGAGTCTTGACCTCAG -3'

Sequencing Primer
(F):5'- ACTCCAGCTTGGAATGAACTG -3'
(R):5'- GGAAACTCAGCTCTGTAATCTGTC -3'

Posted On

2014-01-15