Incidental Mutation 'R1183:Ckap5'
ID101685
Institutional Source Beutler Lab
Gene Symbol Ckap5
Ensembl Gene ENSMUSG00000040549
Gene Namecytoskeleton associated protein 5
Synonyms4930432B04Rik, 3110043H24Rik, D730027C18Rik
MMRRC Submission 039255-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1183 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91526762-91620664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91586266 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1072 (M1072K)
Ref Sequence ENSEMBL: ENSMUSP00000106970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046769] [ENSMUST00000099716] [ENSMUST00000111337] [ENSMUST00000111338]
Predicted Effect probably benign
Transcript: ENSMUST00000046769
AA Change: M1072K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046263
Gene: ENSMUSG00000040549
AA Change: M1072K

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1981 1994 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099716
AA Change: M1072K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097303
Gene: ENSMUSG00000040549
AA Change: M1072K

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1909 1921 N/A INTRINSIC
low complexity region 2002 2015 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111337
AA Change: M1072K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106969
Gene: ENSMUSG00000040549
AA Change: M1072K

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1625 1638 N/A INTRINSIC
low complexity region 1699 1711 N/A INTRINSIC
low complexity region 1849 1861 N/A INTRINSIC
low complexity region 1942 1955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111338
AA Change: M1072K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106970
Gene: ENSMUSG00000040549
AA Change: M1072K

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1909 1921 N/A INTRINSIC
low complexity region 2002 2015 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein which belongs to the TOG/XMAP215 family. The N-terminal half of this protein contains a microtubule-binding domain and the C-terminal half contains a KXGS motif for binding tubulin dimers. This protein has two distinct roles in spindle formation; it protects kinetochore microtubules from depolymerization and plays an essential role in centrosomal microtubule assembly. This protein may be necessary for the proper interaction of microtubules with the cell cortex for directional cell movement. It also plays a role in translation of the myelin basic protein (MBP) mRNA by interacting with heterogeneous nuclear ribonucleoprotein (hnRNP) A2, which associates with MBP. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,895,303 L366Q possibly damaging Het
Aars T G 8: 111,041,574 Y192* probably null Het
Abcc6 T C 7: 45,985,253 Y1100C probably damaging Het
Adamtsl2 T C 2: 27,084,080 W132R probably damaging Het
Adgra2 T A 8: 27,114,388 V497E probably damaging Het
Adtrp T G 13: 41,828,337 probably benign Het
Alg9 T A 9: 50,789,533 L201Q possibly damaging Het
Ap4e1 T A 2: 127,014,201 I84K probably damaging Het
Atrnl1 T C 19: 57,650,293 S288P probably damaging Het
Cacna1a A G 8: 84,580,217 D1367G probably damaging Het
Card19 C T 13: 49,205,251 R82Q probably damaging Het
Cep128 T C 12: 91,325,598 I226V possibly damaging Het
Ces1f A C 8: 93,268,005 D259E probably benign Het
Dcpp2 T A 17: 23,900,494 V94D probably benign Het
Dnah2 T C 11: 69,446,648 D3209G possibly damaging Het
Dsg1c A G 18: 20,283,198 T719A probably damaging Het
Dsp G A 13: 38,191,740 W1167* probably null Het
Eml5 T C 12: 98,792,046 I1874V probably benign Het
Epg5 A G 18: 77,960,711 T645A probably damaging Het
F2rl2 T C 13: 95,701,113 L222S probably damaging Het
Fam114a1 T A 5: 65,034,388 C495S probably damaging Het
Fbn1 A T 2: 125,321,617 D2106E probably benign Het
Fgf14 T A 14: 124,676,524 N65I probably benign Het
Fip1l1 T C 5: 74,595,102 Y497H probably damaging Het
Fn1 A C 1: 71,586,245 D2376E probably damaging Het
Foxd2 T C 4: 114,907,465 T453A possibly damaging Het
Galnt1 G T 18: 24,271,590 W328L probably damaging Het
Gapt A G 13: 110,353,838 V97A possibly damaging Het
Gatad1 A G 5: 3,643,707 V154A possibly damaging Het
Gdf15 A G 8: 70,631,552 F21L probably benign Het
Igdcc4 T C 9: 65,121,900 F273S possibly damaging Het
Invs A T 4: 48,421,725 R786W possibly damaging Het
Itfg1 T G 8: 85,780,523 E236A probably benign Het
Jak3 A T 8: 71,684,550 I752F probably damaging Het
Kcnip3 C A 2: 127,465,065 G144W probably damaging Het
Kctd19 T C 8: 105,382,966 H925R probably benign Het
Kdr C T 5: 75,946,851 A1011T probably damaging Het
Kif13b C A 14: 64,782,377 H1398Q probably benign Het
Lrp4 A T 2: 91,477,519 probably null Het
Lrtm2 T C 6: 119,320,885 D65G probably benign Het
Lyz1 A G 10: 117,292,810 L10P probably damaging Het
Metap2 A T 10: 93,870,184 N245K probably damaging Het
Mms19 T C 19: 41,954,831 D297G possibly damaging Het
Mocs3 A G 2: 168,231,653 D340G possibly damaging Het
Mtfr1l A G 4: 134,529,125 L243P probably damaging Het
Mtss1 A G 15: 58,971,048 I105T probably damaging Het
Myo18a T C 11: 77,857,745 S1967P probably damaging Het
Ncor2 T C 5: 125,023,521 N2248S possibly damaging Het
Nfatc2 T C 2: 168,590,088 D35G possibly damaging Het
Nup210l T A 3: 90,159,945 M764K probably benign Het
Olfr519 A G 7: 108,893,741 L222P probably damaging Het
Otof T C 5: 30,371,912 S1753G probably damaging Het
Otog G A 7: 46,289,755 V2070I probably benign Het
Piezo2 A G 18: 63,086,753 V961A probably damaging Het
Pofut1 C T 2: 153,261,238 S169L probably benign Het
Ppp1r10 T A 17: 35,929,443 S542T possibly damaging Het
Prpf8 T C 11: 75,490,330 Y219H possibly damaging Het
Ptges3l T C 11: 101,421,905 D113G possibly damaging Het
Pycrl G A 15: 75,918,798 L71F probably benign Het
Ramp3 A G 11: 6,674,867 K54E possibly damaging Het
Rbpms C A 8: 33,804,072 Q214H possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo4 C A 9: 37,408,052 D565E probably damaging Het
S100a1 C T 3: 90,511,334 V58I probably benign Het
Setx T A 2: 29,180,092 D2636E probably benign Het
Sun2 A T 15: 79,728,468 V417E probably damaging Het
Tbccd1 T C 16: 22,841,769 N99S probably benign Het
Tex15 A G 8: 33,574,865 D1441G probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Trim32 A G 4: 65,614,391 Y395C probably benign Het
Trpm2 A G 10: 77,923,564 Y1129H probably damaging Het
Trpm8 A T 1: 88,348,091 R470S probably damaging Het
Tsg101 G T 7: 46,889,624 D389E probably benign Het
Ubn1 T C 16: 5,064,542 L46P probably damaging Het
Ubr5 T C 15: 37,997,175 I1745V possibly damaging Het
Usp20 T C 2: 31,011,785 Y521H probably benign Het
Vmn1r159 A T 7: 22,843,594 H4Q probably null Het
Vmn2r27 T A 6: 124,200,532 E504D probably benign Het
Wdr72 A T 9: 74,179,585 I612F probably benign Het
Zbtb8a T C 4: 129,357,727 H317R possibly damaging Het
Zfp507 T C 7: 35,794,890 S243G probably damaging Het
Zfp764 A G 7: 127,406,247 W73R probably damaging Het
Zmym4 A T 4: 126,925,839 D90E probably damaging Het
Other mutations in Ckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Ckap5 APN 2 91606256 missense probably damaging 1.00
IGL00566:Ckap5 APN 2 91568627 splice site probably benign
IGL00585:Ckap5 APN 2 91619825 missense probably damaging 1.00
IGL00910:Ckap5 APN 2 91576050 missense probably benign 0.32
IGL01309:Ckap5 APN 2 91570184 missense probably damaging 0.99
IGL01411:Ckap5 APN 2 91601011 missense probably benign 0.26
IGL01654:Ckap5 APN 2 91577609 missense probably benign 0.26
IGL01684:Ckap5 APN 2 91555354 missense probably benign 0.06
IGL02031:Ckap5 APN 2 91612772 missense possibly damaging 0.85
IGL02057:Ckap5 APN 2 91600707 missense possibly damaging 0.91
IGL02101:Ckap5 APN 2 91572540 splice site probably benign
IGL02250:Ckap5 APN 2 91548901 missense probably damaging 1.00
IGL02556:Ckap5 APN 2 91594841 splice site probably benign
IGL02620:Ckap5 APN 2 91606369 missense probably benign 0.01
IGL02627:Ckap5 APN 2 91576021 missense probably damaging 1.00
IGL02693:Ckap5 APN 2 91570211 missense probably damaging 1.00
IGL02808:Ckap5 APN 2 91596514 missense probably damaging 1.00
IGL03086:Ckap5 APN 2 91570276 splice site probably benign
K7371:Ckap5 UTSW 2 91595523 splice site probably benign
R0106:Ckap5 UTSW 2 91578205 missense possibly damaging 0.90
R0106:Ckap5 UTSW 2 91615840 missense probably damaging 1.00
R0114:Ckap5 UTSW 2 91620112 missense possibly damaging 0.86
R0464:Ckap5 UTSW 2 91579513 missense probably benign 0.00
R0633:Ckap5 UTSW 2 91550743 missense probably damaging 0.96
R0723:Ckap5 UTSW 2 91555331 missense probably damaging 0.99
R1037:Ckap5 UTSW 2 91550629 missense probably benign 0.00
R1139:Ckap5 UTSW 2 91581143 missense probably benign 0.11
R1161:Ckap5 UTSW 2 91599375 missense probably null 1.00
R1660:Ckap5 UTSW 2 91562958 missense possibly damaging 0.92
R1850:Ckap5 UTSW 2 91595713 missense probably damaging 1.00
R1951:Ckap5 UTSW 2 91556492 splice site probably benign
R1968:Ckap5 UTSW 2 91586343 missense probably benign 0.10
R2004:Ckap5 UTSW 2 91607546 missense possibly damaging 0.91
R2143:Ckap5 UTSW 2 91565745 missense probably benign 0.00
R2391:Ckap5 UTSW 2 91585869 missense possibly damaging 0.66
R2435:Ckap5 UTSW 2 91581145 missense probably benign 0.01
R2438:Ckap5 UTSW 2 91595408 missense possibly damaging 0.95
R2680:Ckap5 UTSW 2 91588698 missense probably benign
R2698:Ckap5 UTSW 2 91578081 missense probably damaging 1.00
R3420:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R3422:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R3696:Ckap5 UTSW 2 91620166 missense probably benign 0.15
R3698:Ckap5 UTSW 2 91620166 missense probably benign 0.15
R3877:Ckap5 UTSW 2 91615150 missense possibly damaging 0.69
R4453:Ckap5 UTSW 2 91548845 missense probably damaging 1.00
R4604:Ckap5 UTSW 2 91578131 missense probably benign 0.00
R4605:Ckap5 UTSW 2 91576214 missense probably damaging 1.00
R4849:Ckap5 UTSW 2 91615271 missense probably damaging 1.00
R5267:Ckap5 UTSW 2 91591752 missense probably null 1.00
R5367:Ckap5 UTSW 2 91615141 missense possibly damaging 0.69
R5481:Ckap5 UTSW 2 91572447 missense possibly damaging 0.62
R5546:Ckap5 UTSW 2 91594816 missense probably damaging 1.00
R5704:Ckap5 UTSW 2 91576203 missense probably damaging 1.00
R5786:Ckap5 UTSW 2 91616296 splice site probably null
R5793:Ckap5 UTSW 2 91619835 missense possibly damaging 0.74
R5824:Ckap5 UTSW 2 91559136 missense probably benign 0.34
R5841:Ckap5 UTSW 2 91600682 missense probably benign 0.05
R5875:Ckap5 UTSW 2 91560861 missense probably benign
R5935:Ckap5 UTSW 2 91615100 missense possibly damaging 0.68
R6008:Ckap5 UTSW 2 91562989 missense probably damaging 0.99
R6174:Ckap5 UTSW 2 91568219 missense probably benign 0.00
R6343:Ckap5 UTSW 2 91596474 missense possibly damaging 0.95
R6624:Ckap5 UTSW 2 91577651 missense probably benign 0.01
R6786:Ckap5 UTSW 2 91557575 missense probably benign 0.01
R6793:Ckap5 UTSW 2 91568709 missense probably damaging 1.00
R6841:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R6972:Ckap5 UTSW 2 91606313 missense probably damaging 0.98
R7044:Ckap5 UTSW 2 91577601 missense probably benign
R7111:Ckap5 UTSW 2 91607572 missense probably damaging 1.00
R7790:Ckap5 UTSW 2 91559110 missense probably benign
R7809:Ckap5 UTSW 2 91606357 missense probably benign 0.28
X0010:Ckap5 UTSW 2 91596509 missense possibly damaging 0.61
Z1177:Ckap5 UTSW 2 91585798 missense not run
Predicted Primers PCR Primer
(F):5'- TGGCAGAGAAACTACCTACACTCCG -3'
(R):5'- GCTGTACTGTGAGTTCCTTCAGGTC -3'

Sequencing Primer
(F):5'- AAGGCCCAAGATGCTTTGC -3'
(R):5'- GAGTTCCTTCAGGTCATTGTCAAAG -3'
Posted On2014-01-15