Incidental Mutation 'R1183:Abcc6'
ID 101737
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C member 6
Synonyms DCC, Mrp6, Dyscalc1
MMRRC Submission 039255-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.788) question?
Stock # R1183 (G1)
Quality Score 180
Status Not validated
Chromosome 7
Chromosomal Location 45625804-45679915 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45634677 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1100 (Y1100C)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: Y1100C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: Y1100C

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 T G 8: 111,768,206 (GRCm39) Y192* probably null Het
Adamtsl2 T C 2: 26,974,092 (GRCm39) W132R probably damaging Het
Adgra2 T A 8: 27,604,416 (GRCm39) V497E probably damaging Het
Adtrp T G 13: 41,981,813 (GRCm39) probably benign Het
Alg9 T A 9: 50,700,833 (GRCm39) L201Q possibly damaging Het
Ap4e1 T A 2: 126,856,121 (GRCm39) I84K probably damaging Het
Atrnl1 T C 19: 57,638,725 (GRCm39) S288P probably damaging Het
Bltp1 T A 3: 36,949,452 (GRCm39) L366Q possibly damaging Het
Cacna1a A G 8: 85,306,846 (GRCm39) D1367G probably damaging Het
Card19 C T 13: 49,358,727 (GRCm39) R82Q probably damaging Het
Cep128 T C 12: 91,292,372 (GRCm39) I226V possibly damaging Het
Ces1f A C 8: 93,994,633 (GRCm39) D259E probably benign Het
Ckap5 T A 2: 91,416,611 (GRCm39) M1072K probably benign Het
Dcpp2 T A 17: 24,119,468 (GRCm39) V94D probably benign Het
Dnah2 T C 11: 69,337,474 (GRCm39) D3209G possibly damaging Het
Dsg1c A G 18: 20,416,255 (GRCm39) T719A probably damaging Het
Dsp G A 13: 38,375,716 (GRCm39) W1167* probably null Het
Eml5 T C 12: 98,758,305 (GRCm39) I1874V probably benign Het
Epg5 A G 18: 78,003,926 (GRCm39) T645A probably damaging Het
F2rl2 T C 13: 95,837,621 (GRCm39) L222S probably damaging Het
Fam114a1 T A 5: 65,191,731 (GRCm39) C495S probably damaging Het
Fbn1 A T 2: 125,163,537 (GRCm39) D2106E probably benign Het
Fgf14 T A 14: 124,913,936 (GRCm39) N65I probably benign Het
Fip1l1 T C 5: 74,755,763 (GRCm39) Y497H probably damaging Het
Fn1 A C 1: 71,625,404 (GRCm39) D2376E probably damaging Het
Foxd2 T C 4: 114,764,662 (GRCm39) T453A possibly damaging Het
Galnt1 G T 18: 24,404,647 (GRCm39) W328L probably damaging Het
Gapt A G 13: 110,490,372 (GRCm39) V97A possibly damaging Het
Gatad1 A G 5: 3,693,707 (GRCm39) V154A possibly damaging Het
Gdf15 A G 8: 71,084,202 (GRCm39) F21L probably benign Het
Igdcc4 T C 9: 65,029,182 (GRCm39) F273S possibly damaging Het
Invs A T 4: 48,421,725 (GRCm39) R786W possibly damaging Het
Itfg1 T G 8: 86,507,152 (GRCm39) E236A probably benign Het
Jak3 A T 8: 72,137,194 (GRCm39) I752F probably damaging Het
Kcnip3 C A 2: 127,306,985 (GRCm39) G144W probably damaging Het
Kctd19 T C 8: 106,109,598 (GRCm39) H925R probably benign Het
Kdr C T 5: 76,107,511 (GRCm39) A1011T probably damaging Het
Kif13b C A 14: 65,019,826 (GRCm39) H1398Q probably benign Het
Lrp4 A T 2: 91,307,864 (GRCm39) probably null Het
Lrtm2 T C 6: 119,297,846 (GRCm39) D65G probably benign Het
Lyz1 A G 10: 117,128,715 (GRCm39) L10P probably damaging Het
Metap2 A T 10: 93,706,046 (GRCm39) N245K probably damaging Het
Mms19 T C 19: 41,943,270 (GRCm39) D297G possibly damaging Het
Mocs3 A G 2: 168,073,573 (GRCm39) D340G possibly damaging Het
Mtfr1l A G 4: 134,256,436 (GRCm39) L243P probably damaging Het
Mtss1 A G 15: 58,842,897 (GRCm39) I105T probably damaging Het
Myo18a T C 11: 77,748,571 (GRCm39) S1967P probably damaging Het
Ncor2 T C 5: 125,100,585 (GRCm39) N2248S possibly damaging Het
Nfatc2 T C 2: 168,432,008 (GRCm39) D35G possibly damaging Het
Nup210l T A 3: 90,067,252 (GRCm39) M764K probably benign Het
Or10a3n A G 7: 108,492,948 (GRCm39) L222P probably damaging Het
Otof T C 5: 30,529,256 (GRCm39) S1753G probably damaging Het
Otog G A 7: 45,939,179 (GRCm39) V2070I probably benign Het
Piezo2 A G 18: 63,219,824 (GRCm39) V961A probably damaging Het
Pofut1 C T 2: 153,103,158 (GRCm39) S169L probably benign Het
Ppp1r10 T A 17: 36,240,335 (GRCm39) S542T possibly damaging Het
Prpf8 T C 11: 75,381,156 (GRCm39) Y219H possibly damaging Het
Ptges3l T C 11: 101,312,731 (GRCm39) D113G possibly damaging Het
Pycr3 G A 15: 75,790,647 (GRCm39) L71F probably benign Het
Ramp3 A G 11: 6,624,867 (GRCm39) K54E possibly damaging Het
Rbpms C A 8: 34,294,100 (GRCm39) Q214H possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Robo4 C A 9: 37,319,348 (GRCm39) D565E probably damaging Het
S100a1 C T 3: 90,418,641 (GRCm39) V58I probably benign Het
Setx T A 2: 29,070,104 (GRCm39) D2636E probably benign Het
Sun2 A T 15: 79,612,669 (GRCm39) V417E probably damaging Het
Tbccd1 T C 16: 22,660,519 (GRCm39) N99S probably benign Het
Tex15 A G 8: 34,064,893 (GRCm39) D1441G probably benign Het
Tmc2 T A 2: 130,089,896 (GRCm39) M627K probably damaging Het
Trim32 A G 4: 65,532,628 (GRCm39) Y395C probably benign Het
Trpm2 A G 10: 77,759,398 (GRCm39) Y1129H probably damaging Het
Trpm8 A T 1: 88,275,813 (GRCm39) R470S probably damaging Het
Tsg101 G T 7: 46,539,372 (GRCm39) D389E probably benign Het
Ubn1 T C 16: 4,882,406 (GRCm39) L46P probably damaging Het
Ubr5 T C 15: 37,997,419 (GRCm39) I1745V possibly damaging Het
Usp20 T C 2: 30,901,797 (GRCm39) Y521H probably benign Het
Vmn1r159 A T 7: 22,543,019 (GRCm39) H4Q probably null Het
Vmn2r27 T A 6: 124,177,491 (GRCm39) E504D probably benign Het
Wdr72 A T 9: 74,086,867 (GRCm39) I612F probably benign Het
Zbtb8a T C 4: 129,251,520 (GRCm39) H317R possibly damaging Het
Zfp507 T C 7: 35,494,315 (GRCm39) S243G probably damaging Het
Zfp764 A G 7: 127,005,419 (GRCm39) W73R probably damaging Het
Zmym4 A T 4: 126,819,632 (GRCm39) D90E probably damaging Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 45,652,096 (GRCm39) splice site probably benign
IGL01731:Abcc6 APN 7 45,652,034 (GRCm39) missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45,646,238 (GRCm39) missense probably benign 0.02
IGL01757:Abcc6 APN 7 45,639,705 (GRCm39) splice site probably benign
IGL01895:Abcc6 APN 7 45,678,482 (GRCm39) missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45,635,997 (GRCm39) missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45,626,840 (GRCm39) missense probably damaging 1.00
IGL02277:Abcc6 APN 7 45,650,485 (GRCm39) missense probably benign 0.00
IGL02548:Abcc6 APN 7 45,654,686 (GRCm39) missense probably damaging 0.98
IGL03063:Abcc6 APN 7 45,665,856 (GRCm39) missense probably benign
IGL03092:Abcc6 APN 7 45,635,894 (GRCm39) missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45,631,661 (GRCm39) unclassified probably benign
R0057:Abcc6 UTSW 7 45,669,567 (GRCm39) missense probably benign 0.03
R0944:Abcc6 UTSW 7 45,664,929 (GRCm39) missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 45,663,531 (GRCm39) missense possibly damaging 0.77
R1543:Abcc6 UTSW 7 45,665,928 (GRCm39) missense probably benign 0.01
R1550:Abcc6 UTSW 7 45,654,668 (GRCm39) missense probably benign 0.25
R1725:Abcc6 UTSW 7 45,641,781 (GRCm39) missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 45,663,593 (GRCm39) missense probably benign 0.04
R1908:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R1909:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R2138:Abcc6 UTSW 7 45,630,475 (GRCm39) missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45,648,165 (GRCm39) missense probably benign 0.01
R2402:Abcc6 UTSW 7 45,664,999 (GRCm39) missense probably benign 0.04
R3983:Abcc6 UTSW 7 45,644,713 (GRCm39) missense probably benign
R4013:Abcc6 UTSW 7 45,668,104 (GRCm39) missense probably benign 0.01
R4051:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45,648,256 (GRCm39) splice site probably benign
R4385:Abcc6 UTSW 7 45,644,752 (GRCm39) missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 45,652,031 (GRCm39) missense probably benign
R4479:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45,646,115 (GRCm39) missense probably benign
R4791:Abcc6 UTSW 7 45,631,584 (GRCm39) missense probably benign 0.00
R4895:Abcc6 UTSW 7 45,630,414 (GRCm39) missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45,639,111 (GRCm39) missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45,644,649 (GRCm39) missense probably benign
R4941:Abcc6 UTSW 7 45,661,947 (GRCm39) missense probably benign 0.00
R5040:Abcc6 UTSW 7 45,669,578 (GRCm39) missense probably benign 0.04
R5128:Abcc6 UTSW 7 45,639,070 (GRCm39) missense probably benign 0.00
R5284:Abcc6 UTSW 7 45,630,483 (GRCm39) missense probably benign 0.05
R5328:Abcc6 UTSW 7 45,641,735 (GRCm39) missense probably benign 0.01
R5459:Abcc6 UTSW 7 45,631,607 (GRCm39) missense probably benign 0.00
R5543:Abcc6 UTSW 7 45,638,960 (GRCm39) critical splice donor site probably null
R6178:Abcc6 UTSW 7 45,678,468 (GRCm39) missense probably benign
R6228:Abcc6 UTSW 7 45,679,680 (GRCm39) missense probably benign 0.02
R6532:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45,630,481 (GRCm39) missense probably damaging 1.00
R7000:Abcc6 UTSW 7 45,654,946 (GRCm39) missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 45,668,114 (GRCm39) missense probably benign
R7553:Abcc6 UTSW 7 45,648,545 (GRCm39) missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45,644,661 (GRCm39) missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45,626,816 (GRCm39) missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 45,655,030 (GRCm39) missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45,626,277 (GRCm39) nonsense probably null
R7896:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45,646,089 (GRCm39) missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45,629,449 (GRCm39) missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45,634,569 (GRCm39) missense probably benign
R8784:Abcc6 UTSW 7 45,652,025 (GRCm39) missense probably benign
R8802:Abcc6 UTSW 7 45,658,283 (GRCm39) missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45,648,431 (GRCm39) missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 45,665,820 (GRCm39) missense probably benign 0.00
R9127:Abcc6 UTSW 7 45,629,184 (GRCm39) missense probably damaging 1.00
R9475:Abcc6 UTSW 7 45,665,892 (GRCm39) missense probably damaging 1.00
R9480:Abcc6 UTSW 7 45,629,197 (GRCm39) missense probably damaging 1.00
R9535:Abcc6 UTSW 7 45,626,687 (GRCm39) missense probably damaging 1.00
R9642:Abcc6 UTSW 7 45,639,765 (GRCm39) missense probably benign 0.07
R9715:Abcc6 UTSW 7 45,629,359 (GRCm39) missense probably damaging 1.00
R9731:Abcc6 UTSW 7 45,669,660 (GRCm39) nonsense probably null
X0065:Abcc6 UTSW 7 45,669,621 (GRCm39) missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45,641,730 (GRCm39) critical splice donor site probably null
Z1176:Abcc6 UTSW 7 45,629,158 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATGTGACCCCTCTAACTACAG -3'
(R):5'- GTCCCATTGCTAGGATTCAGCAGC -3'

Sequencing Primer
(F):5'- ACTACAGAGTGCAGCTCTTG -3'
(R):5'- AGCTGTCAGATCCCCCTG -3'
Posted On 2014-01-15