Incidental Mutation 'R1183:Rbpms'
ID101751
Institutional Source Beutler Lab
Gene Symbol Rbpms
Ensembl Gene ENSMUSG00000031586
Gene NameRNA binding protein gene with multiple splicing
Synonymshermes, 2700019M19Rik, 2010300K22Rik
MMRRC Submission 039255-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R1183 (G1)
Quality Score199
Status Not validated
Chromosome8
Chromosomal Location33782643-33929863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 33804072 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 214 (Q214H)
Ref Sequence ENSEMBL: ENSMUSP00000033995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033994] [ENSMUST00000033995] [ENSMUST00000053251] [ENSMUST00000182256] [ENSMUST00000182987] [ENSMUST00000183062] [ENSMUST00000183088] [ENSMUST00000183336] [ENSMUST00000191473]
Predicted Effect probably benign
Transcript: ENSMUST00000033994
SMART Domains Protein: ENSMUSP00000033994
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000033995
AA Change: Q214H

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033995
Gene: ENSMUSG00000031586
AA Change: Q214H

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053251
SMART Domains Protein: ENSMUSP00000055813
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182184
Predicted Effect probably benign
Transcript: ENSMUST00000182256
SMART Domains Protein: ENSMUSP00000138140
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
low complexity region 45 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182926
Predicted Effect probably benign
Transcript: ENSMUST00000182987
SMART Domains Protein: ENSMUSP00000138483
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183062
SMART Domains Protein: ENSMUSP00000138726
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183088
SMART Domains Protein: ENSMUSP00000138420
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
RRM 23 95 7.84e-8 SMART
low complexity region 147 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183336
SMART Domains Protein: ENSMUSP00000138533
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191473
SMART Domains Protein: ENSMUSP00000140387
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231786
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif is between 80-100 amino acids in length and family members contain one to four copies of the motif. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,895,303 L366Q possibly damaging Het
Aars T G 8: 111,041,574 Y192* probably null Het
Abcc6 T C 7: 45,985,253 Y1100C probably damaging Het
Adamtsl2 T C 2: 27,084,080 W132R probably damaging Het
Adgra2 T A 8: 27,114,388 V497E probably damaging Het
Adtrp T G 13: 41,828,337 probably benign Het
Alg9 T A 9: 50,789,533 L201Q possibly damaging Het
Ap4e1 T A 2: 127,014,201 I84K probably damaging Het
Atrnl1 T C 19: 57,650,293 S288P probably damaging Het
Cacna1a A G 8: 84,580,217 D1367G probably damaging Het
Card19 C T 13: 49,205,251 R82Q probably damaging Het
Cep128 T C 12: 91,325,598 I226V possibly damaging Het
Ces1f A C 8: 93,268,005 D259E probably benign Het
Ckap5 T A 2: 91,586,266 M1072K probably benign Het
Dcpp2 T A 17: 23,900,494 V94D probably benign Het
Dnah2 T C 11: 69,446,648 D3209G possibly damaging Het
Dsg1c A G 18: 20,283,198 T719A probably damaging Het
Dsp G A 13: 38,191,740 W1167* probably null Het
Eml5 T C 12: 98,792,046 I1874V probably benign Het
Epg5 A G 18: 77,960,711 T645A probably damaging Het
F2rl2 T C 13: 95,701,113 L222S probably damaging Het
Fam114a1 T A 5: 65,034,388 C495S probably damaging Het
Fbn1 A T 2: 125,321,617 D2106E probably benign Het
Fgf14 T A 14: 124,676,524 N65I probably benign Het
Fip1l1 T C 5: 74,595,102 Y497H probably damaging Het
Fn1 A C 1: 71,586,245 D2376E probably damaging Het
Foxd2 T C 4: 114,907,465 T453A possibly damaging Het
Galnt1 G T 18: 24,271,590 W328L probably damaging Het
Gapt A G 13: 110,353,838 V97A possibly damaging Het
Gatad1 A G 5: 3,643,707 V154A possibly damaging Het
Gdf15 A G 8: 70,631,552 F21L probably benign Het
Igdcc4 T C 9: 65,121,900 F273S possibly damaging Het
Invs A T 4: 48,421,725 R786W possibly damaging Het
Itfg1 T G 8: 85,780,523 E236A probably benign Het
Jak3 A T 8: 71,684,550 I752F probably damaging Het
Kcnip3 C A 2: 127,465,065 G144W probably damaging Het
Kctd19 T C 8: 105,382,966 H925R probably benign Het
Kdr C T 5: 75,946,851 A1011T probably damaging Het
Kif13b C A 14: 64,782,377 H1398Q probably benign Het
Lrp4 A T 2: 91,477,519 probably null Het
Lrtm2 T C 6: 119,320,885 D65G probably benign Het
Lyz1 A G 10: 117,292,810 L10P probably damaging Het
Metap2 A T 10: 93,870,184 N245K probably damaging Het
Mms19 T C 19: 41,954,831 D297G possibly damaging Het
Mocs3 A G 2: 168,231,653 D340G possibly damaging Het
Mtfr1l A G 4: 134,529,125 L243P probably damaging Het
Mtss1 A G 15: 58,971,048 I105T probably damaging Het
Myo18a T C 11: 77,857,745 S1967P probably damaging Het
Ncor2 T C 5: 125,023,521 N2248S possibly damaging Het
Nfatc2 T C 2: 168,590,088 D35G possibly damaging Het
Nup210l T A 3: 90,159,945 M764K probably benign Het
Olfr519 A G 7: 108,893,741 L222P probably damaging Het
Otof T C 5: 30,371,912 S1753G probably damaging Het
Otog G A 7: 46,289,755 V2070I probably benign Het
Piezo2 A G 18: 63,086,753 V961A probably damaging Het
Pofut1 C T 2: 153,261,238 S169L probably benign Het
Ppp1r10 T A 17: 35,929,443 S542T possibly damaging Het
Prpf8 T C 11: 75,490,330 Y219H possibly damaging Het
Ptges3l T C 11: 101,421,905 D113G possibly damaging Het
Pycrl G A 15: 75,918,798 L71F probably benign Het
Ramp3 A G 11: 6,674,867 K54E possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo4 C A 9: 37,408,052 D565E probably damaging Het
S100a1 C T 3: 90,511,334 V58I probably benign Het
Setx T A 2: 29,180,092 D2636E probably benign Het
Sun2 A T 15: 79,728,468 V417E probably damaging Het
Tbccd1 T C 16: 22,841,769 N99S probably benign Het
Tex15 A G 8: 33,574,865 D1441G probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Trim32 A G 4: 65,614,391 Y395C probably benign Het
Trpm2 A G 10: 77,923,564 Y1129H probably damaging Het
Trpm8 A T 1: 88,348,091 R470S probably damaging Het
Tsg101 G T 7: 46,889,624 D389E probably benign Het
Ubn1 T C 16: 5,064,542 L46P probably damaging Het
Ubr5 T C 15: 37,997,175 I1745V possibly damaging Het
Usp20 T C 2: 31,011,785 Y521H probably benign Het
Vmn1r159 A T 7: 22,843,594 H4Q probably null Het
Vmn2r27 T A 6: 124,200,532 E504D probably benign Het
Wdr72 A T 9: 74,179,585 I612F probably benign Het
Zbtb8a T C 4: 129,357,727 H317R possibly damaging Het
Zfp507 T C 7: 35,794,890 S243G probably damaging Het
Zfp764 A G 7: 127,406,247 W73R probably damaging Het
Zmym4 A T 4: 126,925,839 D90E probably damaging Het
Other mutations in Rbpms
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4354001:Rbpms UTSW 8 33806838 missense possibly damaging 0.61
R0637:Rbpms UTSW 8 33806836 missense probably damaging 1.00
R2850:Rbpms UTSW 8 33834377 missense possibly damaging 0.94
R6722:Rbpms UTSW 8 33834393 missense probably damaging 1.00
R7576:Rbpms UTSW 8 33866388 missense probably damaging 1.00
R7689:Rbpms UTSW 8 33864359 missense possibly damaging 0.58
R7763:Rbpms UTSW 8 33789453 missense probably benign
R7909:Rbpms UTSW 8 33864359 missense probably damaging 1.00
R7990:Rbpms UTSW 8 33864359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCGGCTCCAAAATTGTAGCAC -3'
(R):5'- GGCTCACCAGAGACTTGCTCTTAC -3'

Sequencing Primer
(F):5'- CAAAATTGTAGCACCGTGAAAAC -3'
(R):5'- AGCCCAACACACCTGTCTTT -3'
Posted On2014-01-15