Incidental Mutation 'R1183:Gdf15'
ID101753
Institutional Source Beutler Lab
Gene Symbol Gdf15
Ensembl Gene ENSMUSG00000038508
Gene Namegrowth differentiation factor 15
Synonymsmacrophage inhibiting cytokine-1, NAG-1, MIC-1
MMRRC Submission 039255-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1183 (G1)
Quality Score163
Status Not validated
Chromosome8
Chromosomal Location70629393-70632456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70631552 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 21 (F21L)
Ref Sequence ENSEMBL: ENSMUSP00000105730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003808] [ENSMUST00000110103]
Predicted Effect probably benign
Transcript: ENSMUST00000003808
AA Change: F21L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000003808
Gene: ENSMUSG00000038508
AA Change: F21L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
low complexity region 143 166 N/A INTRINSIC
low complexity region 177 195 N/A INTRINSIC
TGFB 206 303 2.81e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110103
AA Change: F21L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105730
Gene: ENSMUSG00000038508
AA Change: F21L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
low complexity region 143 166 N/A INTRINSIC
low complexity region 177 195 N/A INTRINSIC
TGFB 206 303 2.81e-22 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The protein is expressed in a broad range of cell types, acts as a pleiotropic cytokine and is involved in the stress response program of cells after cellular injury. Increased protein levels are associated with disease states such as tissue hypoxia, inflammation, acute injury and oxidative stress. Mice lacking a functional copy of this gene exhibit progressive loss of motor neurons, and more rapid blood clot formation. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice showed no obvious major abnormalities, but exhibit progressive postnatal losses of spinal, facial, and trigeminal motoneurons, accelerated thrombus formation following injury, and decreased bleeding times. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,895,303 L366Q possibly damaging Het
Aars T G 8: 111,041,574 Y192* probably null Het
Abcc6 T C 7: 45,985,253 Y1100C probably damaging Het
Adamtsl2 T C 2: 27,084,080 W132R probably damaging Het
Adgra2 T A 8: 27,114,388 V497E probably damaging Het
Adtrp T G 13: 41,828,337 probably benign Het
Alg9 T A 9: 50,789,533 L201Q possibly damaging Het
Ap4e1 T A 2: 127,014,201 I84K probably damaging Het
Atrnl1 T C 19: 57,650,293 S288P probably damaging Het
Cacna1a A G 8: 84,580,217 D1367G probably damaging Het
Card19 C T 13: 49,205,251 R82Q probably damaging Het
Cep128 T C 12: 91,325,598 I226V possibly damaging Het
Ces1f A C 8: 93,268,005 D259E probably benign Het
Ckap5 T A 2: 91,586,266 M1072K probably benign Het
Dcpp2 T A 17: 23,900,494 V94D probably benign Het
Dnah2 T C 11: 69,446,648 D3209G possibly damaging Het
Dsg1c A G 18: 20,283,198 T719A probably damaging Het
Dsp G A 13: 38,191,740 W1167* probably null Het
Eml5 T C 12: 98,792,046 I1874V probably benign Het
Epg5 A G 18: 77,960,711 T645A probably damaging Het
F2rl2 T C 13: 95,701,113 L222S probably damaging Het
Fam114a1 T A 5: 65,034,388 C495S probably damaging Het
Fbn1 A T 2: 125,321,617 D2106E probably benign Het
Fgf14 T A 14: 124,676,524 N65I probably benign Het
Fip1l1 T C 5: 74,595,102 Y497H probably damaging Het
Fn1 A C 1: 71,586,245 D2376E probably damaging Het
Foxd2 T C 4: 114,907,465 T453A possibly damaging Het
Galnt1 G T 18: 24,271,590 W328L probably damaging Het
Gapt A G 13: 110,353,838 V97A possibly damaging Het
Gatad1 A G 5: 3,643,707 V154A possibly damaging Het
Igdcc4 T C 9: 65,121,900 F273S possibly damaging Het
Invs A T 4: 48,421,725 R786W possibly damaging Het
Itfg1 T G 8: 85,780,523 E236A probably benign Het
Jak3 A T 8: 71,684,550 I752F probably damaging Het
Kcnip3 C A 2: 127,465,065 G144W probably damaging Het
Kctd19 T C 8: 105,382,966 H925R probably benign Het
Kdr C T 5: 75,946,851 A1011T probably damaging Het
Kif13b C A 14: 64,782,377 H1398Q probably benign Het
Lrp4 A T 2: 91,477,519 probably null Het
Lrtm2 T C 6: 119,320,885 D65G probably benign Het
Lyz1 A G 10: 117,292,810 L10P probably damaging Het
Metap2 A T 10: 93,870,184 N245K probably damaging Het
Mms19 T C 19: 41,954,831 D297G possibly damaging Het
Mocs3 A G 2: 168,231,653 D340G possibly damaging Het
Mtfr1l A G 4: 134,529,125 L243P probably damaging Het
Mtss1 A G 15: 58,971,048 I105T probably damaging Het
Myo18a T C 11: 77,857,745 S1967P probably damaging Het
Ncor2 T C 5: 125,023,521 N2248S possibly damaging Het
Nfatc2 T C 2: 168,590,088 D35G possibly damaging Het
Nup210l T A 3: 90,159,945 M764K probably benign Het
Olfr519 A G 7: 108,893,741 L222P probably damaging Het
Otof T C 5: 30,371,912 S1753G probably damaging Het
Otog G A 7: 46,289,755 V2070I probably benign Het
Piezo2 A G 18: 63,086,753 V961A probably damaging Het
Pofut1 C T 2: 153,261,238 S169L probably benign Het
Ppp1r10 T A 17: 35,929,443 S542T possibly damaging Het
Prpf8 T C 11: 75,490,330 Y219H possibly damaging Het
Ptges3l T C 11: 101,421,905 D113G possibly damaging Het
Pycrl G A 15: 75,918,798 L71F probably benign Het
Ramp3 A G 11: 6,674,867 K54E possibly damaging Het
Rbpms C A 8: 33,804,072 Q214H possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo4 C A 9: 37,408,052 D565E probably damaging Het
S100a1 C T 3: 90,511,334 V58I probably benign Het
Setx T A 2: 29,180,092 D2636E probably benign Het
Sun2 A T 15: 79,728,468 V417E probably damaging Het
Tbccd1 T C 16: 22,841,769 N99S probably benign Het
Tex15 A G 8: 33,574,865 D1441G probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Trim32 A G 4: 65,614,391 Y395C probably benign Het
Trpm2 A G 10: 77,923,564 Y1129H probably damaging Het
Trpm8 A T 1: 88,348,091 R470S probably damaging Het
Tsg101 G T 7: 46,889,624 D389E probably benign Het
Ubn1 T C 16: 5,064,542 L46P probably damaging Het
Ubr5 T C 15: 37,997,175 I1745V possibly damaging Het
Usp20 T C 2: 31,011,785 Y521H probably benign Het
Vmn1r159 A T 7: 22,843,594 H4Q probably null Het
Vmn2r27 T A 6: 124,200,532 E504D probably benign Het
Wdr72 A T 9: 74,179,585 I612F probably benign Het
Zbtb8a T C 4: 129,357,727 H317R possibly damaging Het
Zfp507 T C 7: 35,794,890 S243G probably damaging Het
Zfp764 A G 7: 127,406,247 W73R probably damaging Het
Zmym4 A T 4: 126,925,839 D90E probably damaging Het
Other mutations in Gdf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0090:Gdf15 UTSW 8 70629684 missense probably damaging 1.00
R4049:Gdf15 UTSW 8 70629955 missense probably benign
R4820:Gdf15 UTSW 8 70629596 missense probably damaging 1.00
R5893:Gdf15 UTSW 8 70629823 missense possibly damaging 0.96
R6941:Gdf15 UTSW 8 70630144 missense possibly damaging 0.93
R7161:Gdf15 UTSW 8 70631342 missense possibly damaging 0.93
R7690:Gdf15 UTSW 8 70631347 missense possibly damaging 0.68
X0066:Gdf15 UTSW 8 70629625 missense possibly damaging 0.95
Z1176:Gdf15 UTSW 8 70629890 missense not run
Predicted Primers PCR Primer
(F):5'- GCTACTCACCCTCTGGACTGAGTATC -3'
(R):5'- GAATTAGCCTGGTCACCCGAGTTG -3'

Sequencing Primer
(F):5'- ACTTGGTTCTGAGTTCGAGTCC -3'
(R):5'- AGTTGGCATCGCACACG -3'
Posted On2014-01-15