Incidental Mutation 'R1183:Kctd19'
ID101762
Institutional Source Beutler Lab
Gene Symbol Kctd19
Ensembl Gene ENSMUSG00000051648
Gene Namepotassium channel tetramerisation domain containing 19
Synonyms4922504H04Rik
MMRRC Submission 039255-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1183 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105382807-105413502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105382966 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 925 (H925R)
Ref Sequence ENSEMBL: ENSMUSP00000130831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000167294] [ENSMUST00000168196] [ENSMUST00000214056]
Predicted Effect probably benign
Transcript: ENSMUST00000014927
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063071
AA Change: H948R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648
AA Change: H948R

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160191
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161672
Predicted Effect probably benign
Transcript: ENSMUST00000167294
AA Change: H925R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648
AA Change: H925R

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect silent
Transcript: ENSMUST00000168196
Predicted Effect probably benign
Transcript: ENSMUST00000214056
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,895,303 L366Q possibly damaging Het
Aars T G 8: 111,041,574 Y192* probably null Het
Abcc6 T C 7: 45,985,253 Y1100C probably damaging Het
Adamtsl2 T C 2: 27,084,080 W132R probably damaging Het
Adgra2 T A 8: 27,114,388 V497E probably damaging Het
Adtrp T G 13: 41,828,337 probably benign Het
Alg9 T A 9: 50,789,533 L201Q possibly damaging Het
Ap4e1 T A 2: 127,014,201 I84K probably damaging Het
Atrnl1 T C 19: 57,650,293 S288P probably damaging Het
Cacna1a A G 8: 84,580,217 D1367G probably damaging Het
Card19 C T 13: 49,205,251 R82Q probably damaging Het
Cep128 T C 12: 91,325,598 I226V possibly damaging Het
Ces1f A C 8: 93,268,005 D259E probably benign Het
Ckap5 T A 2: 91,586,266 M1072K probably benign Het
Dcpp2 T A 17: 23,900,494 V94D probably benign Het
Dnah2 T C 11: 69,446,648 D3209G possibly damaging Het
Dsg1c A G 18: 20,283,198 T719A probably damaging Het
Dsp G A 13: 38,191,740 W1167* probably null Het
Eml5 T C 12: 98,792,046 I1874V probably benign Het
Epg5 A G 18: 77,960,711 T645A probably damaging Het
F2rl2 T C 13: 95,701,113 L222S probably damaging Het
Fam114a1 T A 5: 65,034,388 C495S probably damaging Het
Fbn1 A T 2: 125,321,617 D2106E probably benign Het
Fgf14 T A 14: 124,676,524 N65I probably benign Het
Fip1l1 T C 5: 74,595,102 Y497H probably damaging Het
Fn1 A C 1: 71,586,245 D2376E probably damaging Het
Foxd2 T C 4: 114,907,465 T453A possibly damaging Het
Galnt1 G T 18: 24,271,590 W328L probably damaging Het
Gapt A G 13: 110,353,838 V97A possibly damaging Het
Gatad1 A G 5: 3,643,707 V154A possibly damaging Het
Gdf15 A G 8: 70,631,552 F21L probably benign Het
Igdcc4 T C 9: 65,121,900 F273S possibly damaging Het
Invs A T 4: 48,421,725 R786W possibly damaging Het
Itfg1 T G 8: 85,780,523 E236A probably benign Het
Jak3 A T 8: 71,684,550 I752F probably damaging Het
Kcnip3 C A 2: 127,465,065 G144W probably damaging Het
Kdr C T 5: 75,946,851 A1011T probably damaging Het
Kif13b C A 14: 64,782,377 H1398Q probably benign Het
Lrp4 A T 2: 91,477,519 probably null Het
Lrtm2 T C 6: 119,320,885 D65G probably benign Het
Lyz1 A G 10: 117,292,810 L10P probably damaging Het
Metap2 A T 10: 93,870,184 N245K probably damaging Het
Mms19 T C 19: 41,954,831 D297G possibly damaging Het
Mocs3 A G 2: 168,231,653 D340G possibly damaging Het
Mtfr1l A G 4: 134,529,125 L243P probably damaging Het
Mtss1 A G 15: 58,971,048 I105T probably damaging Het
Myo18a T C 11: 77,857,745 S1967P probably damaging Het
Ncor2 T C 5: 125,023,521 N2248S possibly damaging Het
Nfatc2 T C 2: 168,590,088 D35G possibly damaging Het
Nup210l T A 3: 90,159,945 M764K probably benign Het
Olfr519 A G 7: 108,893,741 L222P probably damaging Het
Otof T C 5: 30,371,912 S1753G probably damaging Het
Otog G A 7: 46,289,755 V2070I probably benign Het
Piezo2 A G 18: 63,086,753 V961A probably damaging Het
Pofut1 C T 2: 153,261,238 S169L probably benign Het
Ppp1r10 T A 17: 35,929,443 S542T possibly damaging Het
Prpf8 T C 11: 75,490,330 Y219H possibly damaging Het
Ptges3l T C 11: 101,421,905 D113G possibly damaging Het
Pycrl G A 15: 75,918,798 L71F probably benign Het
Ramp3 A G 11: 6,674,867 K54E possibly damaging Het
Rbpms C A 8: 33,804,072 Q214H possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo4 C A 9: 37,408,052 D565E probably damaging Het
S100a1 C T 3: 90,511,334 V58I probably benign Het
Setx T A 2: 29,180,092 D2636E probably benign Het
Sun2 A T 15: 79,728,468 V417E probably damaging Het
Tbccd1 T C 16: 22,841,769 N99S probably benign Het
Tex15 A G 8: 33,574,865 D1441G probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Trim32 A G 4: 65,614,391 Y395C probably benign Het
Trpm2 A G 10: 77,923,564 Y1129H probably damaging Het
Trpm8 A T 1: 88,348,091 R470S probably damaging Het
Tsg101 G T 7: 46,889,624 D389E probably benign Het
Ubn1 T C 16: 5,064,542 L46P probably damaging Het
Ubr5 T C 15: 37,997,175 I1745V possibly damaging Het
Usp20 T C 2: 31,011,785 Y521H probably benign Het
Vmn1r159 A T 7: 22,843,594 H4Q probably null Het
Vmn2r27 T A 6: 124,200,532 E504D probably benign Het
Wdr72 A T 9: 74,179,585 I612F probably benign Het
Zbtb8a T C 4: 129,357,727 H317R possibly damaging Het
Zfp507 T C 7: 35,794,890 S243G probably damaging Het
Zfp764 A G 7: 127,406,247 W73R probably damaging Het
Zmym4 A T 4: 126,925,839 D90E probably damaging Het
Other mutations in Kctd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Kctd19 APN 8 105388463 critical splice donor site probably null
IGL01546:Kctd19 APN 8 105386962 missense probably benign
IGL01786:Kctd19 APN 8 105390304 missense probably benign 0.03
IGL01964:Kctd19 APN 8 105388525 missense probably damaging 0.99
IGL02275:Kctd19 APN 8 105396374 missense probably damaging 0.99
IGL02479:Kctd19 APN 8 105384768 missense probably damaging 1.00
IGL03124:Kctd19 APN 8 105387070 missense possibly damaging 0.48
R0003:Kctd19 UTSW 8 105395361 missense probably damaging 0.99
R1388:Kctd19 UTSW 8 105392051 missense probably null 0.93
R1491:Kctd19 UTSW 8 105387062 missense possibly damaging 0.60
R1517:Kctd19 UTSW 8 105395376 missense probably damaging 1.00
R1540:Kctd19 UTSW 8 105387879 missense probably damaging 0.96
R1582:Kctd19 UTSW 8 105395460 missense probably damaging 1.00
R1964:Kctd19 UTSW 8 105388470 missense probably damaging 0.98
R1996:Kctd19 UTSW 8 105395300 missense probably null 1.00
R2129:Kctd19 UTSW 8 105385172 missense probably damaging 0.98
R2281:Kctd19 UTSW 8 105387266 missense probably benign 0.00
R3767:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R3768:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R4285:Kctd19 UTSW 8 105382949 unclassified probably benign
R4621:Kctd19 UTSW 8 105396471 missense probably damaging 1.00
R4701:Kctd19 UTSW 8 105390429 missense possibly damaging 0.76
R4969:Kctd19 UTSW 8 105396327 splice site probably null
R5070:Kctd19 UTSW 8 105391999 missense probably damaging 1.00
R5401:Kctd19 UTSW 8 105382985 missense probably benign 0.00
R5582:Kctd19 UTSW 8 105408443 missense probably damaging 1.00
R5783:Kctd19 UTSW 8 105386980 missense probably benign
R6056:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6057:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6269:Kctd19 UTSW 8 105395360 missense possibly damaging 0.96
R6273:Kctd19 UTSW 8 105385485 missense probably benign
R6631:Kctd19 UTSW 8 105385328 critical splice donor site probably null
R7298:Kctd19 UTSW 8 105382984 missense probably benign 0.01
R7474:Kctd19 UTSW 8 105392032 missense probably benign 0.25
R7540:Kctd19 UTSW 8 105386935 missense probably benign 0.00
R8059:Kctd19 UTSW 8 105396351 missense not run
Z1088:Kctd19 UTSW 8 105385335 missense probably benign 0.02
Z1176:Kctd19 UTSW 8 105385136 missense not run
Z1177:Kctd19 UTSW 8 105388517 missense not run
Predicted Primers PCR Primer
(F):5'- ACTGGCAGTGACACTCTGTTTTCTC -3'
(R):5'- CACTGTGCTCAGTTCTCTGGTAGC -3'

Sequencing Primer
(F):5'- GTTGACTGGGCATATGCATTCT -3'
(R):5'- TCCCTGCTCAGATAAGGGAG -3'
Posted On2014-01-15