Mutagenetix > Incidental Mutations

Incidental Mutation 'R1183:Aars'

101764

Institutional Source

Beutler Lab

Gene Symbol

Aars

Ensembl Gene

ENSMUSG00000031960

Gene Name

alanyl-tRNA synthetase

Synonyms

MMRRC Submission

039255-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R1183 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

111033144-111057664 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to G at 111041574 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 192 (Y192*)

Ref Sequence

ENSEMBL: ENSMUSP00000034441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034441] [ENSMUST00000125268]

Predicted Effect

probably null
Transcript: ENSMUST00000034441
AA Change: Y192*

SMART Domains

Protein: ENSMUSP00000034441
Gene: ENSMUSG00000031960
AA Change: Y192*

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_2c	9	597	9.2e-228	PFAM
tRNA_SAD	694	753	5.97e-18	SMART
Pfam:DHHA1	885	957	1.6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124285

Predicted Effect

probably benign
Transcript: ENSMUST00000125268

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142770

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145059

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154546

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174930

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 88.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous point mutation (A734E) exhibit a rough sticky coat, follicular dystrophy, patchy hair loss, progressive ataxia, and Purkinje cell degeneration. Homozygotes for a targeted point mutation (C723A) die by mid-gestation, while heterozygotes show mild Purkinje cell loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,895,303	L366Q	possibly damaging	Het
Abcc6	T	C	7: 45,985,253	Y1100C	probably damaging	Het
Adamtsl2	T	C	2: 27,084,080	W132R	probably damaging	Het
Adgra2	T	A	8: 27,114,388	V497E	probably damaging	Het
Adtrp	T	G	13: 41,828,337		probably benign	Het
Alg9	T	A	9: 50,789,533	L201Q	possibly damaging	Het
Ap4e1	T	A	2: 127,014,201	I84K	probably damaging	Het
Atrnl1	T	C	19: 57,650,293	S288P	probably damaging	Het
Cacna1a	A	G	8: 84,580,217	D1367G	probably damaging	Het
Card19	C	T	13: 49,205,251	R82Q	probably damaging	Het
Cep128	T	C	12: 91,325,598	I226V	possibly damaging	Het
Ces1f	A	C	8: 93,268,005	D259E	probably benign	Het
Ckap5	T	A	2: 91,586,266	M1072K	probably benign	Het
Dcpp2	T	A	17: 23,900,494	V94D	probably benign	Het
Dnah2	T	C	11: 69,446,648	D3209G	possibly damaging	Het
Dsg1c	A	G	18: 20,283,198	T719A	probably damaging	Het
Dsp	G	A	13: 38,191,740	W1167*	probably null	Het
Eml5	T	C	12: 98,792,046	I1874V	probably benign	Het
Epg5	A	G	18: 77,960,711	T645A	probably damaging	Het
F2rl2	T	C	13: 95,701,113	L222S	probably damaging	Het
Fam114a1	T	A	5: 65,034,388	C495S	probably damaging	Het
Fbn1	A	T	2: 125,321,617	D2106E	probably benign	Het
Fgf14	T	A	14: 124,676,524	N65I	probably benign	Het
Fip1l1	T	C	5: 74,595,102	Y497H	probably damaging	Het
Fn1	A	C	1: 71,586,245	D2376E	probably damaging	Het
Foxd2	T	C	4: 114,907,465	T453A	possibly damaging	Het
Galnt1	G	T	18: 24,271,590	W328L	probably damaging	Het
Gapt	A	G	13: 110,353,838	V97A	possibly damaging	Het
Gatad1	A	G	5: 3,643,707	V154A	possibly damaging	Het
Gdf15	A	G	8: 70,631,552	F21L	probably benign	Het
Igdcc4	T	C	9: 65,121,900	F273S	possibly damaging	Het
Invs	A	T	4: 48,421,725	R786W	possibly damaging	Het
Itfg1	T	G	8: 85,780,523	E236A	probably benign	Het
Jak3	A	T	8: 71,684,550	I752F	probably damaging	Het
Kcnip3	C	A	2: 127,465,065	G144W	probably damaging	Het
Kctd19	T	C	8: 105,382,966	H925R	probably benign	Het
Kdr	C	T	5: 75,946,851	A1011T	probably damaging	Het
Kif13b	C	A	14: 64,782,377	H1398Q	probably benign	Het
Lrp4	A	T	2: 91,477,519		probably null	Het
Lrtm2	T	C	6: 119,320,885	D65G	probably benign	Het
Lyz1	A	G	10: 117,292,810	L10P	probably damaging	Het
Metap2	A	T	10: 93,870,184	N245K	probably damaging	Het
Mms19	T	C	19: 41,954,831	D297G	possibly damaging	Het
Mocs3	A	G	2: 168,231,653	D340G	possibly damaging	Het
Mtfr1l	A	G	4: 134,529,125	L243P	probably damaging	Het
Mtss1	A	G	15: 58,971,048	I105T	probably damaging	Het
Myo18a	T	C	11: 77,857,745	S1967P	probably damaging	Het
Ncor2	T	C	5: 125,023,521	N2248S	possibly damaging	Het
Nfatc2	T	C	2: 168,590,088	D35G	possibly damaging	Het
Nup210l	T	A	3: 90,159,945	M764K	probably benign	Het
Olfr519	A	G	7: 108,893,741	L222P	probably damaging	Het
Otof	T	C	5: 30,371,912	S1753G	probably damaging	Het
Otog	G	A	7: 46,289,755	V2070I	probably benign	Het
Piezo2	A	G	18: 63,086,753	V961A	probably damaging	Het
Pofut1	C	T	2: 153,261,238	S169L	probably benign	Het
Ppp1r10	T	A	17: 35,929,443	S542T	possibly damaging	Het
Prpf8	T	C	11: 75,490,330	Y219H	possibly damaging	Het
Ptges3l	T	C	11: 101,421,905	D113G	possibly damaging	Het
Pycrl	G	A	15: 75,918,798	L71F	probably benign	Het
Ramp3	A	G	11: 6,674,867	K54E	possibly damaging	Het
Rbpms	C	A	8: 33,804,072	Q214H	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Robo4	C	A	9: 37,408,052	D565E	probably damaging	Het
S100a1	C	T	3: 90,511,334	V58I	probably benign	Het
Setx	T	A	2: 29,180,092	D2636E	probably benign	Het
Sun2	A	T	15: 79,728,468	V417E	probably damaging	Het
Tbccd1	T	C	16: 22,841,769	N99S	probably benign	Het
Tex15	A	G	8: 33,574,865	D1441G	probably benign	Het
Tmc2	T	A	2: 130,247,976	M627K	probably damaging	Het
Trim32	A	G	4: 65,614,391	Y395C	probably benign	Het
Trpm2	A	G	10: 77,923,564	Y1129H	probably damaging	Het
Trpm8	A	T	1: 88,348,091	R470S	probably damaging	Het
Tsg101	G	T	7: 46,889,624	D389E	probably benign	Het
Ubn1	T	C	16: 5,064,542	L46P	probably damaging	Het
Ubr5	T	C	15: 37,997,175	I1745V	possibly damaging	Het
Usp20	T	C	2: 31,011,785	Y521H	probably benign	Het
Vmn1r159	A	T	7: 22,843,594	H4Q	probably null	Het
Vmn2r27	T	A	6: 124,200,532	E504D	probably benign	Het
Wdr72	A	T	9: 74,179,585	I612F	probably benign	Het
Zbtb8a	T	C	4: 129,357,727	H317R	possibly damaging	Het
Zfp507	T	C	7: 35,794,890	S243G	probably damaging	Het
Zfp764	A	G	7: 127,406,247	W73R	probably damaging	Het
Zmym4	A	T	4: 126,925,839	D90E	probably damaging	Het

Other mutations in Aars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Aars	APN	8	111047972	missense	possibly damaging	0.86
IGL00731:Aars	APN	8	111044869	splice site	probably benign
IGL00826:Aars	APN	8	111040300	missense	probably damaging	1.00
IGL01521:Aars	APN	8	111043787	missense	possibly damaging	0.85
IGL01885:Aars	APN	8	111047943	missense	possibly damaging	0.89
IGL01920:Aars	APN	8	111043246	missense	probably damaging	1.00
IGL01934:Aars	APN	8	111048018	missense	probably damaging	0.98
IGL02013:Aars	APN	8	111047066	missense	probably damaging	0.99
IGL02489:Aars	APN	8	111054215	unclassified	probably benign
IGL02683:Aars	APN	8	111052531	unclassified	probably benign
IGL03084:Aars	APN	8	111041629	missense	probably damaging	1.00
H8786:Aars	UTSW	8	111045555	missense	probably benign
R0037:Aars	UTSW	8	111043259	missense	possibly damaging	0.77
R0049:Aars	UTSW	8	111052451	missense	possibly damaging	0.75
R0049:Aars	UTSW	8	111052451	missense	possibly damaging	0.75
R0577:Aars	UTSW	8	111043278	missense	probably benign	0.10
R1642:Aars	UTSW	8	111043250	missense	possibly damaging	0.77
R1829:Aars	UTSW	8	111042706	missense	probably damaging	1.00
R1857:Aars	UTSW	8	111040157	missense	probably damaging	0.99
R2190:Aars	UTSW	8	111040153	missense	probably damaging	1.00
R2303:Aars	UTSW	8	111052502	missense	possibly damaging	0.84
R3918:Aars	UTSW	8	111040142	missense	probably damaging	1.00
R4001:Aars	UTSW	8	111041602	missense	probably damaging	1.00
R4434:Aars	UTSW	8	111054621	missense	probably null	0.74
R4909:Aars	UTSW	8	111055083	missense	probably damaging	1.00
R4970:Aars	UTSW	8	111043679	missense	probably benign	0.00
R5639:Aars	UTSW	8	111043234	missense	probably benign	0.01
R5991:Aars	UTSW	8	111050400	missense	probably damaging	1.00
R6403:Aars	UTSW	8	111042249	missense	possibly damaging	0.87
R6521:Aars	UTSW	8	111043336	missense	probably benign	0.01
R6956:Aars	UTSW	8	111055130	missense	probably benign	0.38
R7378:Aars	UTSW	8	111042342	missense	probably damaging	1.00
R7625:Aars	UTSW	8	111046955	missense	probably damaging	0.99
R7745:Aars	UTSW	8	111041657	missense	probably damaging	1.00
R7792:Aars	UTSW	8	111043264	missense	possibly damaging	0.75
R7860:Aars	UTSW	8	111049861	missense	probably benign	0.16
R8109:Aars	UTSW	8	111040652	missense	probably benign
R8197:Aars	UTSW	8	111053996	missense	probably benign	0.44
R8322:Aars	UTSW	8	111045528	missense	possibly damaging	0.93
R8343:Aars	UTSW	8	111040729	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAAACCGTGACCTCTGAAGGAGTG -3'
(R):5'- CAGAATGTCCAGGAGCACCTGAAG -3'

Sequencing Primer
(F):5'- CTTCATAAGGACTCATAGGGATGC -3'
(R):5'- GCTGTTCTCCAGCTCCAAAAG -3'

Posted On

2014-01-15