Mutagenetix > Incidental Mutations

Incidental Mutation 'R1183:Dsp'

101800

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

039255-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1183 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 38191740 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 1167 (W1167*)

Ref Sequence

ENSEMBL: ENSMUSP00000117252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

Predicted Effect

probably null
Transcript: ENSMUST00000124830
AA Change: W1167*

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: W1167*

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000127906
AA Change: W1167*

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: W1167*

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 88.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,895,303	L366Q	possibly damaging	Het
Aars	T	G	8: 111,041,574	Y192*	probably null	Het
Abcc6	T	C	7: 45,985,253	Y1100C	probably damaging	Het
Adamtsl2	T	C	2: 27,084,080	W132R	probably damaging	Het
Adgra2	T	A	8: 27,114,388	V497E	probably damaging	Het
Adtrp	T	G	13: 41,828,337		probably benign	Het
Alg9	T	A	9: 50,789,533	L201Q	possibly damaging	Het
Ap4e1	T	A	2: 127,014,201	I84K	probably damaging	Het
Atrnl1	T	C	19: 57,650,293	S288P	probably damaging	Het
Cacna1a	A	G	8: 84,580,217	D1367G	probably damaging	Het
Card19	C	T	13: 49,205,251	R82Q	probably damaging	Het
Cep128	T	C	12: 91,325,598	I226V	possibly damaging	Het
Ces1f	A	C	8: 93,268,005	D259E	probably benign	Het
Ckap5	T	A	2: 91,586,266	M1072K	probably benign	Het
Dcpp2	T	A	17: 23,900,494	V94D	probably benign	Het
Dnah2	T	C	11: 69,446,648	D3209G	possibly damaging	Het
Dsg1c	A	G	18: 20,283,198	T719A	probably damaging	Het
Eml5	T	C	12: 98,792,046	I1874V	probably benign	Het
Epg5	A	G	18: 77,960,711	T645A	probably damaging	Het
F2rl2	T	C	13: 95,701,113	L222S	probably damaging	Het
Fam114a1	T	A	5: 65,034,388	C495S	probably damaging	Het
Fbn1	A	T	2: 125,321,617	D2106E	probably benign	Het
Fgf14	T	A	14: 124,676,524	N65I	probably benign	Het
Fip1l1	T	C	5: 74,595,102	Y497H	probably damaging	Het
Fn1	A	C	1: 71,586,245	D2376E	probably damaging	Het
Foxd2	T	C	4: 114,907,465	T453A	possibly damaging	Het
Galnt1	G	T	18: 24,271,590	W328L	probably damaging	Het
Gapt	A	G	13: 110,353,838	V97A	possibly damaging	Het
Gatad1	A	G	5: 3,643,707	V154A	possibly damaging	Het
Gdf15	A	G	8: 70,631,552	F21L	probably benign	Het
Igdcc4	T	C	9: 65,121,900	F273S	possibly damaging	Het
Invs	A	T	4: 48,421,725	R786W	possibly damaging	Het
Itfg1	T	G	8: 85,780,523	E236A	probably benign	Het
Jak3	A	T	8: 71,684,550	I752F	probably damaging	Het
Kcnip3	C	A	2: 127,465,065	G144W	probably damaging	Het
Kctd19	T	C	8: 105,382,966	H925R	probably benign	Het
Kdr	C	T	5: 75,946,851	A1011T	probably damaging	Het
Kif13b	C	A	14: 64,782,377	H1398Q	probably benign	Het
Lrp4	A	T	2: 91,477,519		probably null	Het
Lrtm2	T	C	6: 119,320,885	D65G	probably benign	Het
Lyz1	A	G	10: 117,292,810	L10P	probably damaging	Het
Metap2	A	T	10: 93,870,184	N245K	probably damaging	Het
Mms19	T	C	19: 41,954,831	D297G	possibly damaging	Het
Mocs3	A	G	2: 168,231,653	D340G	possibly damaging	Het
Mtfr1l	A	G	4: 134,529,125	L243P	probably damaging	Het
Mtss1	A	G	15: 58,971,048	I105T	probably damaging	Het
Myo18a	T	C	11: 77,857,745	S1967P	probably damaging	Het
Ncor2	T	C	5: 125,023,521	N2248S	possibly damaging	Het
Nfatc2	T	C	2: 168,590,088	D35G	possibly damaging	Het
Nup210l	T	A	3: 90,159,945	M764K	probably benign	Het
Olfr519	A	G	7: 108,893,741	L222P	probably damaging	Het
Otof	T	C	5: 30,371,912	S1753G	probably damaging	Het
Otog	G	A	7: 46,289,755	V2070I	probably benign	Het
Piezo2	A	G	18: 63,086,753	V961A	probably damaging	Het
Pofut1	C	T	2: 153,261,238	S169L	probably benign	Het
Ppp1r10	T	A	17: 35,929,443	S542T	possibly damaging	Het
Prpf8	T	C	11: 75,490,330	Y219H	possibly damaging	Het
Ptges3l	T	C	11: 101,421,905	D113G	possibly damaging	Het
Pycrl	G	A	15: 75,918,798	L71F	probably benign	Het
Ramp3	A	G	11: 6,674,867	K54E	possibly damaging	Het
Rbpms	C	A	8: 33,804,072	Q214H	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Robo4	C	A	9: 37,408,052	D565E	probably damaging	Het
S100a1	C	T	3: 90,511,334	V58I	probably benign	Het
Setx	T	A	2: 29,180,092	D2636E	probably benign	Het
Sun2	A	T	15: 79,728,468	V417E	probably damaging	Het
Tbccd1	T	C	16: 22,841,769	N99S	probably benign	Het
Tex15	A	G	8: 33,574,865	D1441G	probably benign	Het
Tmc2	T	A	2: 130,247,976	M627K	probably damaging	Het
Trim32	A	G	4: 65,614,391	Y395C	probably benign	Het
Trpm2	A	G	10: 77,923,564	Y1129H	probably damaging	Het
Trpm8	A	T	1: 88,348,091	R470S	probably damaging	Het
Tsg101	G	T	7: 46,889,624	D389E	probably benign	Het
Ubn1	T	C	16: 5,064,542	L46P	probably damaging	Het
Ubr5	T	C	15: 37,997,175	I1745V	possibly damaging	Het
Usp20	T	C	2: 31,011,785	Y521H	probably benign	Het
Vmn1r159	A	T	7: 22,843,594	H4Q	probably null	Het
Vmn2r27	T	A	6: 124,200,532	E504D	probably benign	Het
Wdr72	A	T	9: 74,179,585	I612F	probably benign	Het
Zbtb8a	T	C	4: 129,357,727	H317R	possibly damaging	Het
Zfp507	T	C	7: 35,794,890	S243G	probably damaging	Het
Zfp764	A	G	7: 127,406,247	W73R	probably damaging	Het
Zmym4	A	T	4: 126,925,839	D90E	probably damaging	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38195738	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38193195	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38191619	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38196040	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38167528	nonsense	probably null
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38191710	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38186707	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38191740	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38179073	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38195593	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38188535	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38193548	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38192883	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38197525	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38172843	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38197196	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38176502	critical splice donor site	probably null
R7439:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7441:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38172863	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38192789	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38168766	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38191715	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38191482	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38175207	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38185175	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38191470	missense	probably benign	0.31
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GTGCTACGGTCAGATCAAGGAACTC -3'
(R):5'- CCTGCAAGATGCTGTCATTGAGCC -3'

Sequencing Primer
(F):5'- TCAGATCAAGGAACTCAACGAG -3'
(R):5'- ATGCTGTCATTGAGCCTGACTATC -3'

Posted On

2014-01-15