Incidental Mutation 'R1184:Pld5'
ID 101853
Institutional Source Beutler Lab
Gene Symbol Pld5
Ensembl Gene ENSMUSG00000055214
Gene Name phospholipase D family member 5
Synonyms B230365F16Rik
MMRRC Submission 039256-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1184 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 175789872-176102878 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 175872462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 225 (I225T)
Ref Sequence ENSEMBL: ENSMUSP00000069326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065967] [ENSMUST00000111167] [ENSMUST00000125404]
AlphaFold Q3UNN8
Predicted Effect probably damaging
Transcript: ENSMUST00000065967
AA Change: I225T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069326
Gene: ENSMUSG00000055214
AA Change: I225T

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
PLDc 215 242 3.62e-3 SMART
Pfam:PLDc_3 245 421 2e-101 PFAM
PLDc 434 460 6.11e0 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111167
AA Change: I163T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106797
Gene: ENSMUSG00000055214
AA Change: I163T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PLDc 153 180 3.62e-3 SMART
PLDc 372 398 6.11e0 SMART
low complexity region 449 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125404
SMART Domains Protein: ENSMUSP00000121428
Gene: ENSMUSG00000055214

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156184
Meta Mutation Damage Score 0.9113 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (83/83)
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,137,894 (GRCm39) R7G probably damaging Het
Ahdc1 T A 4: 132,792,707 (GRCm39) M1316K probably benign Het
Alkal1 A G 1: 6,459,712 (GRCm39) Y96C probably damaging Het
Anxa2r1 A T 13: 120,496,667 (GRCm39) N67K probably benign Het
Arhgap17 T C 7: 122,913,913 (GRCm39) Y199C probably damaging Het
Bmp2 T C 2: 133,403,388 (GRCm39) V313A probably damaging Het
Cacna1b C T 2: 24,577,757 (GRCm39) probably null Het
Cars1 T C 7: 143,140,876 (GRCm39) T141A probably damaging Het
Ccdc57 A G 11: 120,764,637 (GRCm39) probably benign Het
Cenpe T C 3: 134,970,183 (GRCm39) probably null Het
Chadl T C 15: 81,577,258 (GRCm39) S198G probably benign Het
Chd6 G C 2: 160,872,722 (GRCm39) P286R probably damaging Het
Clec4a4 G T 6: 122,989,671 (GRCm39) W104L probably benign Het
Coq4 G A 2: 29,678,346 (GRCm39) probably benign Het
Cplane1 G T 15: 8,245,971 (GRCm39) V1448L probably benign Het
Crtc2 T A 3: 90,169,940 (GRCm39) Y445* probably null Het
Dapk1 A T 13: 60,844,112 (GRCm39) I44F probably damaging Het
Dcbld2 T A 16: 58,270,204 (GRCm39) probably null Het
Dcun1d4 T C 5: 73,668,455 (GRCm39) probably benign Het
Depdc7 A T 2: 104,560,523 (GRCm39) probably benign Het
Dna2 A G 10: 62,794,977 (GRCm39) D416G probably benign Het
Dnah2 A T 11: 69,390,016 (GRCm39) I743N probably damaging Het
Dnah9 A G 11: 65,975,438 (GRCm39) probably null Het
Dock3 A G 9: 106,846,999 (GRCm39) S877P probably damaging Het
Eif3l T A 15: 78,959,966 (GRCm39) probably null Het
Epha5 A T 5: 84,219,134 (GRCm39) probably null Het
Ffar3 T A 7: 30,554,529 (GRCm39) N264Y probably damaging Het
Fyb1 A T 15: 6,668,381 (GRCm39) I525F probably damaging Het
Fyco1 A G 9: 123,648,218 (GRCm39) F1239L probably damaging Het
Gcdh T C 8: 85,620,071 (GRCm39) probably benign Het
Gk5 T C 9: 96,032,473 (GRCm39) probably benign Het
Grm1 A G 10: 10,595,778 (GRCm39) Y617H probably benign Het
Gvin-ps3 A G 7: 105,683,159 (GRCm39) V32A probably benign Het
Hhipl2 A T 1: 183,206,042 (GRCm39) I131L probably damaging Het
Larp4b T C 13: 9,216,345 (GRCm39) probably benign Het
Lrig2 T A 3: 104,398,227 (GRCm39) I301F possibly damaging Het
Man2a2 A T 7: 80,012,713 (GRCm39) I600N possibly damaging Het
Mylk2 G C 2: 152,755,661 (GRCm39) probably null Het
Myo6 C T 9: 80,193,664 (GRCm39) Q870* probably null Het
Napg T G 18: 63,127,409 (GRCm39) H204Q probably benign Het
Neb G A 2: 52,153,959 (GRCm39) T2384M probably damaging Het
Nek10 A G 14: 14,931,325 (GRCm38) probably benign Het
Or11h23 A C 14: 50,948,071 (GRCm39) T95P probably benign Het
Or4c111 A G 2: 88,844,057 (GRCm39) M117T probably damaging Het
Or5an6 T C 19: 12,372,221 (GRCm39) V198A probably benign Het
Or5b108 T G 19: 13,168,739 (GRCm39) L236R probably damaging Het
Pclo A G 5: 14,572,276 (GRCm39) T554A unknown Het
Perm1 C A 4: 156,301,771 (GRCm39) T105K probably damaging Het
Pik3r1 T C 13: 101,822,866 (GRCm39) probably null Het
Plxnc1 T C 10: 94,667,195 (GRCm39) probably benign Het
Ptpn12 A C 5: 21,203,354 (GRCm39) S475A possibly damaging Het
Ptprt A G 2: 161,769,692 (GRCm39) V391A possibly damaging Het
Rac2 T G 15: 78,450,145 (GRCm39) D65A possibly damaging Het
Rgl3 A G 9: 21,888,676 (GRCm39) probably null Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Sebox A T 11: 78,394,675 (GRCm39) T47S probably damaging Het
Sema4b A G 7: 79,874,388 (GRCm39) T593A probably benign Het
Serpina3a C T 12: 104,082,787 (GRCm39) Q187* probably null Het
Serpinb1a T C 13: 33,027,199 (GRCm39) K248E probably benign Het
Serpinb9e A C 13: 33,443,757 (GRCm39) E259A probably benign Het
Slc30a3 T A 5: 31,247,510 (GRCm39) H44L probably damaging Het
Smarca2 T C 19: 26,748,333 (GRCm39) probably benign Het
Snrnp200 T A 2: 127,078,737 (GRCm39) C1801S probably damaging Het
Soat1 G A 1: 156,269,944 (GRCm39) probably null Het
Spink6 T C 18: 44,204,605 (GRCm39) probably benign Het
Spta1 G A 1: 174,012,256 (GRCm39) R354H probably damaging Het
Tbck T A 3: 132,543,733 (GRCm39) H861Q probably benign Het
Tgfbrap1 G A 1: 43,088,856 (GRCm39) T849M possibly damaging Het
Tnrc6a A G 7: 122,769,563 (GRCm39) N451S possibly damaging Het
Trim36 T C 18: 46,329,318 (GRCm39) T41A probably damaging Het
Trmt112 C A 19: 6,887,721 (GRCm39) probably benign Het
Trpc4ap A G 2: 155,486,990 (GRCm39) probably benign Het
Ttll7 C T 3: 146,645,746 (GRCm39) P535S probably damaging Het
Ttn A T 2: 76,691,776 (GRCm39) probably benign Het
Txndc11 C T 16: 10,946,364 (GRCm39) R149Q probably benign Het
Ubr4 C T 4: 139,164,509 (GRCm39) probably benign Het
Usp30 G A 5: 114,241,888 (GRCm39) probably null Het
Vmn1r195 A G 13: 22,463,181 (GRCm39) Y217C probably damaging Het
Vps33b T A 7: 79,932,234 (GRCm39) D135E probably benign Het
Vrk2 A G 11: 26,433,331 (GRCm39) probably benign Het
Wdr81 G T 11: 75,343,809 (GRCm39) P486Q probably damaging Het
Zfp788 T C 7: 41,297,750 (GRCm39) Y129H probably damaging Het
Other mutations in Pld5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pld5 APN 1 175,967,585 (GRCm39) missense probably damaging 1.00
IGL00949:Pld5 APN 1 175,803,039 (GRCm39) missense probably damaging 1.00
IGL01067:Pld5 APN 1 176,102,445 (GRCm39) utr 5 prime probably benign
IGL02174:Pld5 APN 1 176,102,310 (GRCm39) missense possibly damaging 0.86
IGL02380:Pld5 APN 1 175,967,610 (GRCm39) missense probably damaging 0.97
IGL02879:Pld5 APN 1 175,798,157 (GRCm39) missense probably damaging 1.00
R0087:Pld5 UTSW 1 175,812,025 (GRCm39) missense probably damaging 0.98
R0135:Pld5 UTSW 1 175,798,155 (GRCm39) missense probably damaging 1.00
R0144:Pld5 UTSW 1 175,798,107 (GRCm39) missense probably benign 0.00
R0362:Pld5 UTSW 1 175,803,146 (GRCm39) nonsense probably null
R0453:Pld5 UTSW 1 175,917,522 (GRCm39) missense possibly damaging 0.75
R0454:Pld5 UTSW 1 176,102,295 (GRCm39) missense probably benign 0.00
R0722:Pld5 UTSW 1 175,803,081 (GRCm39) missense probably benign 0.34
R0751:Pld5 UTSW 1 175,872,462 (GRCm39) missense probably damaging 0.98
R0785:Pld5 UTSW 1 175,803,018 (GRCm39) splice site probably benign
R1501:Pld5 UTSW 1 175,803,087 (GRCm39) missense probably benign 0.36
R1644:Pld5 UTSW 1 175,803,192 (GRCm39) missense possibly damaging 0.86
R2012:Pld5 UTSW 1 175,791,579 (GRCm39) missense probably benign 0.27
R2426:Pld5 UTSW 1 175,791,542 (GRCm39) missense probably benign
R3508:Pld5 UTSW 1 175,821,603 (GRCm39) missense probably damaging 1.00
R3917:Pld5 UTSW 1 175,791,504 (GRCm39) missense probably benign 0.00
R4207:Pld5 UTSW 1 175,821,441 (GRCm39) missense probably damaging 1.00
R4373:Pld5 UTSW 1 175,967,583 (GRCm39) missense probably damaging 1.00
R4828:Pld5 UTSW 1 176,102,433 (GRCm39) missense probably benign 0.06
R4831:Pld5 UTSW 1 176,102,450 (GRCm39) utr 5 prime probably benign
R5861:Pld5 UTSW 1 175,917,571 (GRCm39) missense probably damaging 1.00
R6182:Pld5 UTSW 1 175,872,420 (GRCm39) missense probably benign 0.35
R6191:Pld5 UTSW 1 175,798,100 (GRCm39) missense probably benign 0.04
R6246:Pld5 UTSW 1 175,791,475 (GRCm39) nonsense probably null
R6737:Pld5 UTSW 1 175,917,588 (GRCm39) missense probably damaging 1.00
R7082:Pld5 UTSW 1 175,917,442 (GRCm39) missense probably benign 0.21
R7164:Pld5 UTSW 1 176,041,187 (GRCm39) start codon destroyed probably null 0.00
R7237:Pld5 UTSW 1 176,102,301 (GRCm39) missense possibly damaging 0.79
R7635:Pld5 UTSW 1 175,821,416 (GRCm39) critical splice donor site probably null
R7805:Pld5 UTSW 1 175,872,480 (GRCm39) missense probably damaging 1.00
R7967:Pld5 UTSW 1 176,102,264 (GRCm39) missense probably benign 0.03
R8038:Pld5 UTSW 1 175,872,463 (GRCm39) missense probably benign 0.19
R8995:Pld5 UTSW 1 175,791,580 (GRCm39) missense probably benign 0.01
R9033:Pld5 UTSW 1 175,967,585 (GRCm39) missense probably damaging 0.99
R9067:Pld5 UTSW 1 175,917,474 (GRCm39) missense probably benign 0.00
R9156:Pld5 UTSW 1 175,902,003 (GRCm39) missense probably benign 0.05
R9156:Pld5 UTSW 1 175,803,104 (GRCm39) missense possibly damaging 0.73
R9712:Pld5 UTSW 1 175,791,572 (GRCm39) missense probably benign 0.01
X0004:Pld5 UTSW 1 176,089,088 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AACACTGGATTGGGGAATGTGCC -3'
(R):5'- TAGCATCATAAGCGCCTTCGTCACC -3'

Sequencing Primer
(F):5'- TGTGCCTCAATGGTAGAAAGC -3'
(R):5'- TGTGCAAGTACCTGGCTC -3'
Posted On 2014-01-15