Incidental Mutation 'R1184:Ptprt'
ID 101879
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
MMRRC Submission 039256-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R1184 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 161769692 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 391 (V391A)
Ref Sequence ENSEMBL: ENSMUSP00000105068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000109441
AA Change: V391A

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: V391A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109442
AA Change: V391A

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: V391A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109443
AA Change: V391A

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: V391A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109445
AA Change: V391A

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: V391A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.1775 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,137,894 (GRCm39) R7G probably damaging Het
Ahdc1 T A 4: 132,792,707 (GRCm39) M1316K probably benign Het
Alkal1 A G 1: 6,459,712 (GRCm39) Y96C probably damaging Het
Anxa2r1 A T 13: 120,496,667 (GRCm39) N67K probably benign Het
Arhgap17 T C 7: 122,913,913 (GRCm39) Y199C probably damaging Het
Bmp2 T C 2: 133,403,388 (GRCm39) V313A probably damaging Het
Cacna1b C T 2: 24,577,757 (GRCm39) probably null Het
Cars1 T C 7: 143,140,876 (GRCm39) T141A probably damaging Het
Ccdc57 A G 11: 120,764,637 (GRCm39) probably benign Het
Cenpe T C 3: 134,970,183 (GRCm39) probably null Het
Chadl T C 15: 81,577,258 (GRCm39) S198G probably benign Het
Chd6 G C 2: 160,872,722 (GRCm39) P286R probably damaging Het
Clec4a4 G T 6: 122,989,671 (GRCm39) W104L probably benign Het
Coq4 G A 2: 29,678,346 (GRCm39) probably benign Het
Cplane1 G T 15: 8,245,971 (GRCm39) V1448L probably benign Het
Crtc2 T A 3: 90,169,940 (GRCm39) Y445* probably null Het
Dapk1 A T 13: 60,844,112 (GRCm39) I44F probably damaging Het
Dcbld2 T A 16: 58,270,204 (GRCm39) probably null Het
Dcun1d4 T C 5: 73,668,455 (GRCm39) probably benign Het
Depdc7 A T 2: 104,560,523 (GRCm39) probably benign Het
Dna2 A G 10: 62,794,977 (GRCm39) D416G probably benign Het
Dnah2 A T 11: 69,390,016 (GRCm39) I743N probably damaging Het
Dnah9 A G 11: 65,975,438 (GRCm39) probably null Het
Dock3 A G 9: 106,846,999 (GRCm39) S877P probably damaging Het
Eif3l T A 15: 78,959,966 (GRCm39) probably null Het
Epha5 A T 5: 84,219,134 (GRCm39) probably null Het
Ffar3 T A 7: 30,554,529 (GRCm39) N264Y probably damaging Het
Fyb1 A T 15: 6,668,381 (GRCm39) I525F probably damaging Het
Fyco1 A G 9: 123,648,218 (GRCm39) F1239L probably damaging Het
Gcdh T C 8: 85,620,071 (GRCm39) probably benign Het
Gk5 T C 9: 96,032,473 (GRCm39) probably benign Het
Grm1 A G 10: 10,595,778 (GRCm39) Y617H probably benign Het
Gvin-ps3 A G 7: 105,683,159 (GRCm39) V32A probably benign Het
Hhipl2 A T 1: 183,206,042 (GRCm39) I131L probably damaging Het
Larp4b T C 13: 9,216,345 (GRCm39) probably benign Het
Lrig2 T A 3: 104,398,227 (GRCm39) I301F possibly damaging Het
Man2a2 A T 7: 80,012,713 (GRCm39) I600N possibly damaging Het
Mylk2 G C 2: 152,755,661 (GRCm39) probably null Het
Myo6 C T 9: 80,193,664 (GRCm39) Q870* probably null Het
Napg T G 18: 63,127,409 (GRCm39) H204Q probably benign Het
Neb G A 2: 52,153,959 (GRCm39) T2384M probably damaging Het
Nek10 A G 14: 14,931,325 (GRCm38) probably benign Het
Or11h23 A C 14: 50,948,071 (GRCm39) T95P probably benign Het
Or4c111 A G 2: 88,844,057 (GRCm39) M117T probably damaging Het
Or5an6 T C 19: 12,372,221 (GRCm39) V198A probably benign Het
Or5b108 T G 19: 13,168,739 (GRCm39) L236R probably damaging Het
Pclo A G 5: 14,572,276 (GRCm39) T554A unknown Het
Perm1 C A 4: 156,301,771 (GRCm39) T105K probably damaging Het
Pik3r1 T C 13: 101,822,866 (GRCm39) probably null Het
Pld5 A G 1: 175,872,462 (GRCm39) I225T probably damaging Het
Plxnc1 T C 10: 94,667,195 (GRCm39) probably benign Het
Ptpn12 A C 5: 21,203,354 (GRCm39) S475A possibly damaging Het
Rac2 T G 15: 78,450,145 (GRCm39) D65A possibly damaging Het
Rgl3 A G 9: 21,888,676 (GRCm39) probably null Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Sebox A T 11: 78,394,675 (GRCm39) T47S probably damaging Het
Sema4b A G 7: 79,874,388 (GRCm39) T593A probably benign Het
Serpina3a C T 12: 104,082,787 (GRCm39) Q187* probably null Het
Serpinb1a T C 13: 33,027,199 (GRCm39) K248E probably benign Het
Serpinb9e A C 13: 33,443,757 (GRCm39) E259A probably benign Het
Slc30a3 T A 5: 31,247,510 (GRCm39) H44L probably damaging Het
Smarca2 T C 19: 26,748,333 (GRCm39) probably benign Het
Snrnp200 T A 2: 127,078,737 (GRCm39) C1801S probably damaging Het
Soat1 G A 1: 156,269,944 (GRCm39) probably null Het
Spink6 T C 18: 44,204,605 (GRCm39) probably benign Het
Spta1 G A 1: 174,012,256 (GRCm39) R354H probably damaging Het
Tbck T A 3: 132,543,733 (GRCm39) H861Q probably benign Het
Tgfbrap1 G A 1: 43,088,856 (GRCm39) T849M possibly damaging Het
Tnrc6a A G 7: 122,769,563 (GRCm39) N451S possibly damaging Het
Trim36 T C 18: 46,329,318 (GRCm39) T41A probably damaging Het
Trmt112 C A 19: 6,887,721 (GRCm39) probably benign Het
Trpc4ap A G 2: 155,486,990 (GRCm39) probably benign Het
Ttll7 C T 3: 146,645,746 (GRCm39) P535S probably damaging Het
Ttn A T 2: 76,691,776 (GRCm39) probably benign Het
Txndc11 C T 16: 10,946,364 (GRCm39) R149Q probably benign Het
Ubr4 C T 4: 139,164,509 (GRCm39) probably benign Het
Usp30 G A 5: 114,241,888 (GRCm39) probably null Het
Vmn1r195 A G 13: 22,463,181 (GRCm39) Y217C probably damaging Het
Vps33b T A 7: 79,932,234 (GRCm39) D135E probably benign Het
Vrk2 A G 11: 26,433,331 (GRCm39) probably benign Het
Wdr81 G T 11: 75,343,809 (GRCm39) P486Q probably damaging Het
Zfp788 T C 7: 41,297,750 (GRCm39) Y129H probably damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,769,404 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,652,469 (GRCm39) critical splice donor site probably null
R1939:Ptprt UTSW 2 161,769,560 (GRCm39) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,608,241 (GRCm39) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,653,908 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,406,609 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,402,159 (GRCm39) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,120,143 (GRCm39) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,372,367 (GRCm39) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,449,225 (GRCm39) missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161,417,707 (GRCm39) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,372,361 (GRCm39) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATACTGCTGCTGGTTGAACACG -3'
(R):5'- CCTCATTGGAACTCTCATGAAGCCC -3'

Sequencing Primer
(F):5'- CTGCTGGTTGAACACGTACTG -3'
(R):5'- gatacatctacctctgcttccc -3'
Posted On 2014-01-15