Incidental Mutation 'R1184:Dapk1'
ID101966
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Namedeath associated protein kinase 1
SynonymsDAP-Kinase, 2310039H24Rik, D13Ucla1, 2810425C21Rik
MMRRC Submission 039256-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1184 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location60601947-60763191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60696298 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 44 (I44F)
Ref Sequence ENSEMBL: ENSMUSP00000153607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
Predicted Effect probably damaging
Transcript: ENSMUST00000044083
AA Change: I44F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: I44F

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077453
AA Change: I44F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: I44F

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224340
Predicted Effect probably benign
Transcript: ENSMUST00000224789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225632
Predicted Effect probably damaging
Transcript: ENSMUST00000226059
AA Change: I44F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7352 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,160,912 R7G probably damaging Het
2410089E03Rik G T 15: 8,216,487 V1448L probably benign Het
Ahdc1 T A 4: 133,065,396 M1316K probably benign Het
Alkal1 A G 1: 6,389,488 Y96C probably damaging Het
Arhgap17 T C 7: 123,314,690 Y199C probably damaging Het
Bmp2 T C 2: 133,561,468 V313A probably damaging Het
Cacna1b C T 2: 24,687,745 probably null Het
Cars T C 7: 143,587,139 T141A probably damaging Het
Ccdc57 A G 11: 120,873,811 probably benign Het
Cenpe T C 3: 135,264,422 probably null Het
Chadl T C 15: 81,693,057 S198G probably benign Het
Chd6 G C 2: 161,030,802 P286R probably damaging Het
Clec4a4 G T 6: 123,012,712 W104L probably benign Het
Coq4 G A 2: 29,788,334 probably benign Het
Crtc2 T A 3: 90,262,633 Y445* probably null Het
Dcbld2 T A 16: 58,449,841 probably null Het
Dcun1d4 T C 5: 73,511,112 probably benign Het
Depdc7 A T 2: 104,730,178 probably benign Het
Dna2 A G 10: 62,959,198 D416G probably benign Het
Dnah2 A T 11: 69,499,190 I743N probably damaging Het
Dnah9 A G 11: 66,084,612 probably null Het
Dock3 A G 9: 106,969,800 S877P probably damaging Het
Eif3l T A 15: 79,075,766 probably null Het
Epha5 A T 5: 84,071,275 probably null Het
Ffar3 T A 7: 30,855,104 N264Y probably damaging Het
Fyb A T 15: 6,638,900 I525F probably damaging Het
Fyco1 A G 9: 123,819,153 F1239L probably damaging Het
Gcdh T C 8: 84,893,442 probably benign Het
Gk5 T C 9: 96,150,420 probably benign Het
Gm21188 A T 13: 120,035,131 N67K probably benign Het
Gm8979 A G 7: 106,083,952 V32A probably benign Het
Grm1 A G 10: 10,720,034 Y617H probably benign Het
Hhipl2 A T 1: 183,425,134 I131L probably damaging Het
Larp4b T C 13: 9,166,309 probably benign Het
Lrig2 T A 3: 104,490,911 I301F possibly damaging Het
Man2a2 A T 7: 80,362,965 I600N possibly damaging Het
Mylk2 G C 2: 152,913,741 probably null Het
Myo6 C T 9: 80,286,382 Q870* probably null Het
Napg T G 18: 62,994,338 H204Q probably benign Het
Neb G A 2: 52,263,947 T2384M probably damaging Het
Nek10 A G 14: 14,931,325 probably benign Het
Olfr1216 A G 2: 89,013,713 M117T probably damaging Het
Olfr1440 T C 19: 12,394,857 V198A probably benign Het
Olfr1462 T G 19: 13,191,375 L236R probably damaging Het
Olfr748 A C 14: 50,710,614 T95P probably benign Het
Pclo A G 5: 14,522,262 T554A unknown Het
Perm1 C A 4: 156,217,314 T105K probably damaging Het
Pik3r1 T C 13: 101,686,358 probably null Het
Pld5 A G 1: 176,044,896 I225T probably damaging Het
Plxnc1 T C 10: 94,831,333 probably benign Het
Ptpn12 A C 5: 20,998,356 S475A possibly damaging Het
Ptprt A G 2: 161,927,772 V391A possibly damaging Het
Rac2 T G 15: 78,565,945 D65A possibly damaging Het
Rgl3 A G 9: 21,977,380 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sebox A T 11: 78,503,849 T47S probably damaging Het
Sema4b A G 7: 80,224,640 T593A probably benign Het
Serpina3a C T 12: 104,116,528 Q187* probably null Het
Serpinb1a T C 13: 32,843,216 K248E probably benign Het
Serpinb9e A C 13: 33,259,774 E259A probably benign Het
Slc30a3 T A 5: 31,090,166 H44L probably damaging Het
Smarca2 T C 19: 26,770,933 probably benign Het
Snrnp200 T A 2: 127,236,817 C1801S probably damaging Het
Soat1 G A 1: 156,442,374 probably null Het
Spink6 T C 18: 44,071,538 probably benign Het
Spta1 G A 1: 174,184,690 R354H probably damaging Het
Tbck T A 3: 132,837,972 H861Q probably benign Het
Tgfbrap1 G A 1: 43,049,696 T849M possibly damaging Het
Tnrc6a A G 7: 123,170,340 N451S possibly damaging Het
Trim36 T C 18: 46,196,251 T41A probably damaging Het
Trmt112 C A 19: 6,910,353 probably benign Het
Trpc4ap A G 2: 155,645,070 probably benign Het
Ttll7 C T 3: 146,939,991 P535S probably damaging Het
Ttn A T 2: 76,861,432 probably benign Het
Txndc11 C T 16: 11,128,500 R149Q probably benign Het
Ubr4 C T 4: 139,437,198 probably benign Het
Usp30 G A 5: 114,103,827 probably null Het
Vmn1r195 A G 13: 22,279,011 Y217C probably damaging Het
Vps33b T A 7: 80,282,486 D135E probably benign Het
Vrk2 A G 11: 26,483,331 probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Zfp788 T C 7: 41,648,326 Y129H probably damaging Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60761040 missense probably benign 0.23
IGL00500:Dapk1 APN 13 60760804 missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60761248 missense probably benign 0.00
IGL00903:Dapk1 APN 13 60761397 missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60760798 missense probably benign
IGL01535:Dapk1 APN 13 60731031 splice site probably benign
IGL01755:Dapk1 APN 13 60761175 missense probably damaging 0.97
IGL01755:Dapk1 APN 13 60761176 missense possibly damaging 0.63
IGL01862:Dapk1 APN 13 60726610 missense probably benign 0.39
IGL01985:Dapk1 APN 13 60736260 missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60730882 missense probably benign
IGL02376:Dapk1 APN 13 60696394 missense probably benign 0.00
IGL02449:Dapk1 APN 13 60719770 splice site probably benign
IGL02490:Dapk1 APN 13 60749334 missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60761807 nonsense probably null
IGL02516:Dapk1 APN 13 60696347 missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60751217 missense probably benign
IGL02604:Dapk1 APN 13 60748320 missense probably benign
IGL03035:Dapk1 APN 13 60716773 missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60761312 missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60718149 splice site probably benign
R0116:Dapk1 UTSW 13 60761100 missense probably benign
R0165:Dapk1 UTSW 13 60761593 missense probably benign 0.39
R0357:Dapk1 UTSW 13 60729558 nonsense probably null
R0446:Dapk1 UTSW 13 60725287 splice site probably null
R0502:Dapk1 UTSW 13 60730848 synonymous probably null
R0503:Dapk1 UTSW 13 60730848 synonymous probably null
R0597:Dapk1 UTSW 13 60761384 missense probably benign 0.40
R0614:Dapk1 UTSW 13 60718132 missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60757448 missense probably benign 0.14
R1023:Dapk1 UTSW 13 60730985 missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60721865 critical splice donor site probably null
R1101:Dapk1 UTSW 13 60716785 missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60754143 missense probably benign 0.28
R1630:Dapk1 UTSW 13 60729531 missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60718464 critical splice donor site probably null
R1799:Dapk1 UTSW 13 60719654 missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60721857 missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60751208 missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60729531 missense possibly damaging 0.91
R2131:Dapk1 UTSW 13 60761667 missense possibly damaging 0.80
R2154:Dapk1 UTSW 13 60729503 missense probably benign 0.36
R2288:Dapk1 UTSW 13 60761749 missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60757353 missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60730931 missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60752216 missense probably benign 0.34
R2909:Dapk1 UTSW 13 60716817 critical splice donor site probably null
R2926:Dapk1 UTSW 13 60719750 missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60748200 missense probably benign 0.09
R3810:Dapk1 UTSW 13 60760689 missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4375:Dapk1 UTSW 13 60761589 missense probably benign
R4377:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4490:Dapk1 UTSW 13 60718128 missense probably benign 0.26
R4576:Dapk1 UTSW 13 60721822 missense probably benign 0.13
R4599:Dapk1 UTSW 13 60718047 missense probably benign 0.22
R4682:Dapk1 UTSW 13 60751147 missense probably benign 0.41
R4717:Dapk1 UTSW 13 60726662 critical splice donor site probably null
R4775:Dapk1 UTSW 13 60749342 missense probably benign 0.02
R4790:Dapk1 UTSW 13 60723105 frame shift probably null
R4897:Dapk1 UTSW 13 60761786 missense probably benign 0.01
R4931:Dapk1 UTSW 13 60760960 missense probably benign 0.04
R5113:Dapk1 UTSW 13 60721778 missense probably benign 0.01
R5503:Dapk1 UTSW 13 60725312 missense probably benign 0.15
R5948:Dapk1 UTSW 13 60729395 missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60761662 missense probably benign 0.00
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60761766 missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60761326 missense probably benign 0.01
R6331:Dapk1 UTSW 13 60729442 nonsense probably null
R6553:Dapk1 UTSW 13 60761161 missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60761347 missense probably benign 0.03
R6602:Dapk1 UTSW 13 60749204 missense probably benign 0.20
R6640:Dapk1 UTSW 13 60716814 missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60760894 missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60725340 missense probably benign 0.22
R6799:Dapk1 UTSW 13 60752235 missense probably benign
R6809:Dapk1 UTSW 13 60751289 missense probably benign 0.00
R6915:Dapk1 UTSW 13 60696442 missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60736324 missense probably benign 0.11
R6979:Dapk1 UTSW 13 60748281 missense probably damaging 1.00
R7161:Dapk1 UTSW 13 60696395 missense possibly damaging 0.89
R7171:Dapk1 UTSW 13 60761785 missense probably damaging 0.97
R7199:Dapk1 UTSW 13 60754210 missense probably benign 0.02
R7203:Dapk1 UTSW 13 60696335 missense possibly damaging 0.90
R7404:Dapk1 UTSW 13 60719641 missense probably benign 0.00
R7448:Dapk1 UTSW 13 60751176 missense probably damaging 1.00
R7480:Dapk1 UTSW 13 60757497 missense probably benign 0.18
R7532:Dapk1 UTSW 13 60730886 missense probably damaging 1.00
R7574:Dapk1 UTSW 13 60761173 missense probably damaging 1.00
R7711:Dapk1 UTSW 13 60761551 missense probably damaging 1.00
R7753:Dapk1 UTSW 13 60751193 missense possibly damaging 0.58
R7804:Dapk1 UTSW 13 60725339 missense probably benign 0.41
R7822:Dapk1 UTSW 13 60725901 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGTCCGTGTGTCCCCATGTTATG -3'
(R):5'- ATCTTTCAGGCAGCTCAGGCTCAG -3'

Sequencing Primer
(F):5'- GTGTCCCCATGTTATGTCCTTG -3'
(R):5'- TTGGGATAACGATAGCCCATGC -3'
Posted On2014-01-15