Incidental Mutation 'R1185:Cd69'
ID102032
Institutional Source Beutler Lab
Gene Symbol Cd69
Ensembl Gene ENSMUSG00000030156
Gene NameCD69 antigen
SynonymsVEA, AIM, 5830438K24Rik
MMRRC Submission 039257-MU
Accession Numbers

Genbank: NM_001033122; MGI: 88343

Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1185 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location129267325-129275436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129270185 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 23 (G23D)
Ref Sequence ENSEMBL: ENSMUSP00000144734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032259] [ENSMUST00000204411]
Predicted Effect probably damaging
Transcript: ENSMUST00000032259
AA Change: G64D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032259
Gene: ENSMUSG00000030156
AA Change: G64D

DomainStartEndE-ValueType
Blast:CLECT 3 42 3e-8 BLAST
low complexity region 44 61 N/A INTRINSIC
CLECT 85 195 3e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203727
Predicted Effect probably damaging
Transcript: ENSMUST00000204411
AA Change: G23D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144734
Gene: ENSMUSG00000030156
AA Change: G23D

DomainStartEndE-ValueType
CLECT 44 154 1.5e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205190
Meta Mutation Damage Score 0.3763 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 96.3%
  • 10x: 87.8%
  • 20x: 68.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium dependent lectin superfamily of type II transmembrane receptors. Expression of the encoded protein is induced upon activation of T lymphocytes, and may play a role in proliferation. Furthermore, the protein may act to transmit signals in natural killer cells and platelets. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in slightly increased pre-B and immature B cell numbers in the bone marrow, and increased IgG2a and IgM response to T cell-dependent and T cell-independent antigens. Mutant mice were less prone to collagen inducedarthritis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aimp2 A G 5: 143,904,691 S110P possibly damaging Het
Akap9 A G 5: 3,948,783 T51A probably benign Het
Arhgef25 A G 10: 127,183,781 F430L possibly damaging Het
Brap T C 5: 121,675,279 V235A probably damaging Het
Cecr2 C T 6: 120,758,205 R24* probably null Het
Celsr2 T C 3: 108,399,709 D1974G possibly damaging Het
Cps1 A G 1: 67,195,199 K915R probably benign Het
Csmd1 T C 8: 16,358,348 D401G probably damaging Het
Dusp13 A G 14: 21,735,018 F141S probably damaging Het
Fam162b A G 10: 51,590,343 W27R probably benign Het
Focad A G 4: 88,178,187 T269A probably benign Het
Ghr T A 15: 3,328,062 R241S possibly damaging Het
Gm21319 A G 12: 87,773,708 V27A probably benign Het
Hirip3 AAGAG AAG 7: 126,863,660 probably null Het
Itgb2l A G 16: 96,429,040 Y357H possibly damaging Het
Jrkl T C 9: 13,244,933 D241G possibly damaging Het
Lmod1 A G 1: 135,364,229 D274G probably benign Het
Lrrn2 A G 1: 132,939,221 S675G probably benign Het
Ltbp4 G C 7: 27,310,535 P1200R probably damaging Het
Mdn1 T C 4: 32,735,576 L3414P possibly damaging Het
Myo16 T A 8: 10,633,624 S1856T probably damaging Het
Neb A G 2: 52,296,298 Y921H probably damaging Het
Olfr135 T A 17: 38,209,183 *313R probably null Het
Pgap3 T C 11: 98,391,134 D117G probably damaging Het
Ppp1r9b T C 11: 95,001,986 F671L possibly damaging Het
Proser3 G A 7: 30,546,147 A144V probably benign Het
Purg T G 8: 33,386,869 Y178* probably null Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sorbs1 T A 19: 40,382,606 D79V probably damaging Het
Tcaf3 T C 6: 42,591,434 T663A probably damaging Het
Timd4 C A 11: 46,817,648 T167K probably damaging Het
Tjp2 A G 19: 24,131,163 L195P possibly damaging Het
Tnr G A 1: 159,852,286 A277T probably benign Het
Ttc30a1 A T 2: 75,980,352 N462K probably damaging Het
Unc13a C T 8: 71,661,833 G181D probably benign Het
Vmn1r11 T A 6: 57,137,507 L52Q possibly damaging Het
Vmn2r125 C A 4: 156,351,101 A258D probably benign Het
Zfp27 T C 7: 29,895,829 D237G possibly damaging Het
Zfp39 T C 11: 58,902,844 T23A possibly damaging Het
Zfp459 T G 13: 67,408,481 N161T probably benign Het
Other mutations in Cd69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Cd69 APN 6 129268320 missense probably damaging 1.00
IGL02799:Cd69 APN 6 129268260 splice site probably benign
Jazzed UTSW 6 129269574 critical splice donor site probably null
Surrogate UTSW 6 129269580 missense probably benign 0.00
3-1:Cd69 UTSW 6 129275249 missense probably damaging 0.99
R0119:Cd69 UTSW 6 129270062 missense probably benign 0.01
R0136:Cd69 UTSW 6 129270062 missense probably benign 0.01
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R2327:Cd69 UTSW 6 129271388 missense probably damaging 1.00
R2352:Cd69 UTSW 6 129269604 missense probably damaging 1.00
R3955:Cd69 UTSW 6 129268380 splice site probably null
R4780:Cd69 UTSW 6 129271355 missense probably damaging 1.00
R5400:Cd69 UTSW 6 129269991 missense probably benign 0.01
R5522:Cd69 UTSW 6 129271416 missense probably damaging 0.97
R6594:Cd69 UTSW 6 129269574 critical splice donor site probably null
R6737:Cd69 UTSW 6 129268299 missense probably benign 0.04
R6972:Cd69 UTSW 6 129269580 missense probably benign 0.00
R7240:Cd69 UTSW 6 129270042 missense possibly damaging 0.78
R7694:Cd69 UTSW 6 129270045 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCCTCCACGACTAAGTTTCGCTAC -3'
(R):5'- GACAACACAACCCTTTGTTCATGCC -3'

Sequencing Primer
(F):5'- AGACAGGTGCCCAGTTTC -3'
(R):5'- CCCATCCTGTCCTGAGTGAC -3'
Posted On2014-01-15