Incidental Mutation 'R1185:Arhgef25'
ID102052
Institutional Source Beutler Lab
Gene Symbol Arhgef25
Ensembl Gene ENSMUSG00000019467
Gene NameRho guanine nucleotide exchange factor (GEF) 25
SynonymsD10Ertd610e, 2410008H17Rik, GEFT
MMRRC Submission 039257-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R1185 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127182525-127190083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127183781 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 430 (F430L)
Ref Sequence ENSEMBL: ENSMUSP00000151325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019611] [ENSMUST00000095270] [ENSMUST00000167353] [ENSMUST00000218587] [ENSMUST00000218654] [ENSMUST00000219245] [ENSMUST00000222006] [ENSMUST00000222911]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019611
AA Change: F469L

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467
AA Change: F469L

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095270
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167353
AA Change: F460L

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467
AA Change: F460L

DomainStartEndE-ValueType
low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218478
Predicted Effect probably benign
Transcript: ENSMUST00000218587
Predicted Effect possibly damaging
Transcript: ENSMUST00000218654
AA Change: F430L

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000218864
Predicted Effect probably benign
Transcript: ENSMUST00000219245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221174
Predicted Effect probably benign
Transcript: ENSMUST00000222006
Predicted Effect probably benign
Transcript: ENSMUST00000222911
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 96.3%
  • 10x: 87.8%
  • 20x: 68.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases alternate between an inactive GDP-bound state and an active GTP-bound state, and GEFs facilitate GDP/GTP exchange. This gene encodes a guanine nucleotide exchange factor (GEF) which interacts with Rho GTPases involved in contraction of vascular smooth muscles, regulation of responses to angiotensin II and lens cell differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in the second heart field exhibit normal cardiac development and prenatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aimp2 A G 5: 143,904,691 S110P possibly damaging Het
Akap9 A G 5: 3,948,783 T51A probably benign Het
Brap T C 5: 121,675,279 V235A probably damaging Het
Cd69 C T 6: 129,270,185 G23D probably damaging Het
Cecr2 C T 6: 120,758,205 R24* probably null Het
Celsr2 T C 3: 108,399,709 D1974G possibly damaging Het
Cps1 A G 1: 67,195,199 K915R probably benign Het
Csmd1 T C 8: 16,358,348 D401G probably damaging Het
Dusp13 A G 14: 21,735,018 F141S probably damaging Het
Fam162b A G 10: 51,590,343 W27R probably benign Het
Focad A G 4: 88,178,187 T269A probably benign Het
Ghr T A 15: 3,328,062 R241S possibly damaging Het
Gm21319 A G 12: 87,773,708 V27A probably benign Het
Hirip3 AAGAG AAG 7: 126,863,660 probably null Het
Itgb2l A G 16: 96,429,040 Y357H possibly damaging Het
Jrkl T C 9: 13,244,933 D241G possibly damaging Het
Lmod1 A G 1: 135,364,229 D274G probably benign Het
Lrrn2 A G 1: 132,939,221 S675G probably benign Het
Ltbp4 G C 7: 27,310,535 P1200R probably damaging Het
Mdn1 T C 4: 32,735,576 L3414P possibly damaging Het
Myo16 T A 8: 10,633,624 S1856T probably damaging Het
Neb A G 2: 52,296,298 Y921H probably damaging Het
Olfr135 T A 17: 38,209,183 *313R probably null Het
Pgap3 T C 11: 98,391,134 D117G probably damaging Het
Ppp1r9b T C 11: 95,001,986 F671L possibly damaging Het
Proser3 G A 7: 30,546,147 A144V probably benign Het
Purg T G 8: 33,386,869 Y178* probably null Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sorbs1 T A 19: 40,382,606 D79V probably damaging Het
Tcaf3 T C 6: 42,591,434 T663A probably damaging Het
Timd4 C A 11: 46,817,648 T167K probably damaging Het
Tjp2 A G 19: 24,131,163 L195P possibly damaging Het
Tnr G A 1: 159,852,286 A277T probably benign Het
Ttc30a1 A T 2: 75,980,352 N462K probably damaging Het
Unc13a C T 8: 71,661,833 G181D probably benign Het
Vmn1r11 T A 6: 57,137,507 L52Q possibly damaging Het
Vmn2r125 C A 4: 156,351,101 A258D probably benign Het
Zfp27 T C 7: 29,895,829 D237G possibly damaging Het
Zfp39 T C 11: 58,902,844 T23A possibly damaging Het
Zfp459 T G 13: 67,408,481 N161T probably benign Het
Other mutations in Arhgef25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Arhgef25 APN 10 127184170 missense probably damaging 1.00
IGL02499:Arhgef25 APN 10 127185591 missense probably damaging 1.00
IGL03276:Arhgef25 APN 10 127185925 missense possibly damaging 0.78
R0021:Arhgef25 UTSW 10 127189554 missense probably benign 0.00
R0038:Arhgef25 UTSW 10 127186865 splice site probably benign
R0038:Arhgef25 UTSW 10 127186865 splice site probably benign
R0106:Arhgef25 UTSW 10 127184010 critical splice donor site probably null
R0242:Arhgef25 UTSW 10 127184064 missense probably damaging 1.00
R0242:Arhgef25 UTSW 10 127184064 missense probably damaging 1.00
R0358:Arhgef25 UTSW 10 127184453 missense probably damaging 1.00
R0505:Arhgef25 UTSW 10 127183697 missense probably null 0.03
R0676:Arhgef25 UTSW 10 127184010 critical splice donor site probably null
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1600:Arhgef25 UTSW 10 127185289 missense probably damaging 0.99
R1846:Arhgef25 UTSW 10 127185864 missense probably damaging 1.00
R2055:Arhgef25 UTSW 10 127185135 missense probably damaging 1.00
R2254:Arhgef25 UTSW 10 127189521 missense probably benign 0.01
R2496:Arhgef25 UTSW 10 127187194 missense probably benign 0.08
R3836:Arhgef25 UTSW 10 127189736 missense probably benign
R3837:Arhgef25 UTSW 10 127189736 missense probably benign
R3838:Arhgef25 UTSW 10 127189736 missense probably benign
R3839:Arhgef25 UTSW 10 127189736 missense probably benign
R3950:Arhgef25 UTSW 10 127185144 missense probably damaging 1.00
R3980:Arhgef25 UTSW 10 127187220 missense probably damaging 1.00
R4883:Arhgef25 UTSW 10 127182933 missense probably benign 0.43
R4964:Arhgef25 UTSW 10 127185603 missense probably damaging 1.00
R5192:Arhgef25 UTSW 10 127185109 missense probably damaging 1.00
R5196:Arhgef25 UTSW 10 127185109 missense probably damaging 1.00
R5420:Arhgef25 UTSW 10 127187274 missense probably benign 0.37
R6301:Arhgef25 UTSW 10 127185882 missense possibly damaging 0.88
R6764:Arhgef25 UTSW 10 127184101 missense probably damaging 1.00
R7096:Arhgef25 UTSW 10 127184028 missense probably damaging 1.00
R7289:Arhgef25 UTSW 10 127183772 missense possibly damaging 0.92
R7482:Arhgef25 UTSW 10 127185671 missense probably damaging 1.00
X0018:Arhgef25 UTSW 10 127183699 missense probably damaging 1.00
X0024:Arhgef25 UTSW 10 127183257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGACCGATCACTTTCCCTGCC -3'
(R):5'- TTCTTGGTTACAGAGCCTGAAGCTG -3'

Sequencing Primer
(F):5'- CCAATGTAAGGTGCTTGGAAC -3'
(R):5'- GCAAATCATCATCTTCAGTGAGGC -3'
Posted On2014-01-15