Incidental Mutation 'R1185:Dusp13'
ID102069
Institutional Source Beutler Lab
Gene Symbol Dusp13
Ensembl Gene ENSMUSG00000021768
Gene Namedual specificity phosphatase 13
SynonymsTMDP, TS-DSP6, LMW-DSP6, LOC382853
MMRRC Submission 039257-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1185 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location21733394-21751181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21735018 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 141 (F141S)
Ref Sequence ENSEMBL: ENSMUSP00000139154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075040] [ENSMUST00000119866] [ENSMUST00000120956] [ENSMUST00000120984] [ENSMUST00000127851] [ENSMUST00000183698] [ENSMUST00000183893] [ENSMUST00000183943] [ENSMUST00000184571] [ENSMUST00000184703]
Predicted Effect probably benign
Transcript: ENSMUST00000075040
SMART Domains Protein: ENSMUSP00000074553
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 37 181 7.66e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119866
AA Change: F209S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112552
Gene: ENSMUSG00000021768
AA Change: F209S

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120956
AA Change: F156S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113305
Gene: ENSMUSG00000021768
AA Change: F156S

DomainStartEndE-ValueType
DSPc 110 255 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120984
AA Change: F91S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113985
Gene: ENSMUSG00000021768
AA Change: F91S

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127851
SMART Domains Protein: ENSMUSP00000120977
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
SCOP:d1vhra_ 20 133 9e-10 SMART
Blast:DSPc 37 129 5e-60 BLAST
PDB:2E0T|A 39 129 1e-26 PDB
low complexity region 162 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183698
AA Change: F114S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139058
Gene: ENSMUSG00000021768
AA Change: F114S

DomainStartEndE-ValueType
DSPc 68 213 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183893
SMART Domains Protein: ENSMUSP00000139061
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183943
AA Change: F141S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139154
Gene: ENSMUSG00000021768
AA Change: F141S

DomainStartEndE-ValueType
internal_repeat_1 19 71 6.78e-8 PROSPERO
DSPc 95 240 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184571
Predicted Effect probably damaging
Transcript: ENSMUST00000184703
AA Change: F91S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138972
Gene: ENSMUSG00000021768
AA Change: F91S

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Meta Mutation Damage Score 0.2014 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 96.3%
  • 10x: 87.8%
  • 20x: 68.2%
Validation Efficiency
MGI Phenotype FUNCTION: Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In humans, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aimp2 A G 5: 143,904,691 S110P possibly damaging Het
Akap9 A G 5: 3,948,783 T51A probably benign Het
Arhgef25 A G 10: 127,183,781 F430L possibly damaging Het
Brap T C 5: 121,675,279 V235A probably damaging Het
Cd69 C T 6: 129,270,185 G23D probably damaging Het
Cecr2 C T 6: 120,758,205 R24* probably null Het
Celsr2 T C 3: 108,399,709 D1974G possibly damaging Het
Cps1 A G 1: 67,195,199 K915R probably benign Het
Csmd1 T C 8: 16,358,348 D401G probably damaging Het
Fam162b A G 10: 51,590,343 W27R probably benign Het
Focad A G 4: 88,178,187 T269A probably benign Het
Ghr T A 15: 3,328,062 R241S possibly damaging Het
Gm21319 A G 12: 87,773,708 V27A probably benign Het
Hirip3 AAGAG AAG 7: 126,863,660 probably null Het
Itgb2l A G 16: 96,429,040 Y357H possibly damaging Het
Jrkl T C 9: 13,244,933 D241G possibly damaging Het
Lmod1 A G 1: 135,364,229 D274G probably benign Het
Lrrn2 A G 1: 132,939,221 S675G probably benign Het
Ltbp4 G C 7: 27,310,535 P1200R probably damaging Het
Mdn1 T C 4: 32,735,576 L3414P possibly damaging Het
Myo16 T A 8: 10,633,624 S1856T probably damaging Het
Neb A G 2: 52,296,298 Y921H probably damaging Het
Olfr135 T A 17: 38,209,183 *313R probably null Het
Pgap3 T C 11: 98,391,134 D117G probably damaging Het
Ppp1r9b T C 11: 95,001,986 F671L possibly damaging Het
Proser3 G A 7: 30,546,147 A144V probably benign Het
Purg T G 8: 33,386,869 Y178* probably null Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sorbs1 T A 19: 40,382,606 D79V probably damaging Het
Tcaf3 T C 6: 42,591,434 T663A probably damaging Het
Timd4 C A 11: 46,817,648 T167K probably damaging Het
Tjp2 A G 19: 24,131,163 L195P possibly damaging Het
Tnr G A 1: 159,852,286 A277T probably benign Het
Ttc30a1 A T 2: 75,980,352 N462K probably damaging Het
Unc13a C T 8: 71,661,833 G181D probably benign Het
Vmn1r11 T A 6: 57,137,507 L52Q possibly damaging Het
Vmn2r125 C A 4: 156,351,101 A258D probably benign Het
Zfp27 T C 7: 29,895,829 D237G possibly damaging Het
Zfp39 T C 11: 58,902,844 T23A possibly damaging Het
Zfp459 T G 13: 67,408,481 N161T probably benign Het
Other mutations in Dusp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Dusp13 APN 14 21733839 missense probably damaging 1.00
IGL02963:Dusp13 APN 14 21733807 missense possibly damaging 0.86
R0827:Dusp13 UTSW 14 21742771 missense probably benign
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1882:Dusp13 UTSW 14 21734975 missense probably benign 0.04
R2915:Dusp13 UTSW 14 21740137 missense probably damaging 1.00
R3954:Dusp13 UTSW 14 21740107 missense probably damaging 1.00
R4623:Dusp13 UTSW 14 21743478 unclassified probably benign
R4837:Dusp13 UTSW 14 21743525 utr 3 prime probably benign
R6713:Dusp13 UTSW 14 21748473 missense probably damaging 1.00
R7294:Dusp13 UTSW 14 21733714 missense possibly damaging 0.47
R7782:Dusp13 UTSW 14 21741336 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTGGAGAAATAGTTCCTCATCCCGC -3'
(R):5'- CGCTTTTATCACCAGGGCAGTTCAC -3'

Sequencing Primer
(F):5'- CCTCATCCCGCCCTGAC -3'
(R):5'- ACCAGGGCAGTTCACTGTTTC -3'
Posted On2014-01-15