Incidental Mutation 'R1186:Olfr1084'
ID 102085
Institutional Source Beutler Lab
Gene Symbol Olfr1084
Ensembl Gene ENSMUSG00000110804
Gene Name olfactory receptor 1084
Synonyms GA_x6K02T2Q125-48121788-48120847, MOR192-2, MOR192-3
MMRRC Submission 039258-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock # R1186 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 86638765-86639725 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86639463 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 82 (L82M)
Gene Model predicted gene model for transcript(s): [ENSMUST00000216851]
AlphaFold A0A1L1STZ9
Predicted Effect probably damaging
Transcript: ENSMUST00000099880
AA Change: L82M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097465
Gene: ENSMUSG00000075177
AA Change: L82M

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.9e-48 PFAM
Pfam:7tm_1 41 290 7.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216851
AA Change: L82M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Alpk2 T C 18: 65,294,341 probably null Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Ddx5 T C 11: 106,783,979 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Galnt17 G T 5: 131,111,742 T179K probably damaging Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Inpp5f T C 7: 128,694,583 I195T probably benign Het
Isyna1 C A 8: 70,595,201 N115K probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Med24 T C 11: 98,717,757 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
P2rx7 T C 5: 122,670,451 Y299H probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Senp2 T C 16: 22,011,504 S38P probably damaging Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Spry2 A G 14: 105,892,907 C282R probably damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Usp46 C T 5: 74,002,122 A312T probably benign Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Vmn2r6 T A 3: 64,565,067 M78L probably benign Het
Zfp407 A T 18: 84,209,448 I2012N probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in Olfr1084
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Olfr1084 APN 2 86639166 missense probably benign 0.01
IGL01376:Olfr1084 APN 2 86639609 missense probably benign 0.00
IGL01387:Olfr1084 APN 2 86639250 missense probably benign 0.03
IGL01549:Olfr1084 APN 2 86639361 missense probably benign 0.29
IGL01549:Olfr1084 APN 2 86639532 missense possibly damaging 0.95
IGL01572:Olfr1084 APN 2 86638939 missense possibly damaging 0.92
IGL02084:Olfr1084 APN 2 86639636 missense possibly damaging 0.89
IGL02289:Olfr1084 APN 2 86639519 missense probably damaging 1.00
IGL02422:Olfr1084 APN 2 86639216 missense probably damaging 0.99
IGL02691:Olfr1084 APN 2 86638838 missense probably damaging 1.00
IGL02829:Olfr1084 APN 2 86639255 missense possibly damaging 0.60
IGL02859:Olfr1084 APN 2 86639648 missense probably benign 0.01
R0441:Olfr1084 UTSW 2 86639330 missense probably damaging 1.00
R0546:Olfr1084 UTSW 2 86639229 missense possibly damaging 0.86
R4465:Olfr1084 UTSW 2 86639134 missense probably benign 0.28
R4554:Olfr1084 UTSW 2 86638779 missense possibly damaging 0.74
R4670:Olfr1084 UTSW 2 86639168 missense possibly damaging 0.95
R4945:Olfr1084 UTSW 2 86639489 missense probably damaging 0.99
R5348:Olfr1084 UTSW 2 86638806 missense probably benign 0.39
R5888:Olfr1084 UTSW 2 86639144 missense probably damaging 0.98
R7001:Olfr1084 UTSW 2 86639151 missense probably benign 0.20
R7258:Olfr1084 UTSW 2 86639001 nonsense probably null
R7526:Olfr1084 UTSW 2 86639669 missense possibly damaging 0.93
R7646:Olfr1084 UTSW 2 86639169 missense probably damaging 1.00
R7915:Olfr1084 UTSW 2 86638766 makesense probably null
Predicted Primers PCR Primer
(F):5'- TTGTAACCACTGTCAGGTGGGACC -3'
(R):5'- GGAATCACTGAGAACCCTGAGCTG -3'

Sequencing Primer
(F):5'- GAGTTCATCCTGAGAACAGCTATG -3'
(R):5'- GCAGGCTCCATTGTTTGG -3'
Posted On 2014-01-15