Incidental Mutation 'R1186:Usp46'
ID 102106
Institutional Source Beutler Lab
Gene Symbol Usp46
Ensembl Gene ENSMUSG00000054814
Gene Name ubiquitin specific peptidase 46
Synonyms 1190009E20Rik, 2410018I08Rik
MMRRC Submission 039258-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R1186 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 73998453-74068431 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74002122 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 312 (A312T)
Ref Sequence ENSEMBL: ENSMUSP00000114060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068058] [ENSMUST00000119154]
AlphaFold P62069
Predicted Effect probably benign
Transcript: ENSMUST00000068058
AA Change: A339T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000070554
Gene: ENSMUSG00000054814
AA Change: A339T

DomainStartEndE-ValueType
Pfam:UCH 34 362 6.8e-67 PFAM
Pfam:UCH_1 35 335 1.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119154
AA Change: A312T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000114060
Gene: ENSMUSG00000054814
AA Change: A312T

DomainStartEndE-ValueType
Pfam:UCH 9 335 4.1e-67 PFAM
Pfam:UCH_1 11 308 2.9e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128750
Meta Mutation Damage Score 0.0812 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP46 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Alpk2 T C 18: 65,294,341 probably null Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Ddx5 T C 11: 106,783,979 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Galnt17 G T 5: 131,111,742 T179K probably damaging Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Inpp5f T C 7: 128,694,583 I195T probably benign Het
Isyna1 C A 8: 70,595,201 N115K probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Med24 T C 11: 98,717,757 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1084 A T 2: 86,639,463 L82M probably damaging Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
P2rx7 T C 5: 122,670,451 Y299H probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Senp2 T C 16: 22,011,504 S38P probably damaging Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Spry2 A G 14: 105,892,907 C282R probably damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Vmn2r6 T A 3: 64,565,067 M78L probably benign Het
Zfp407 A T 18: 84,209,448 I2012N probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in Usp46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Usp46 APN 5 74002686 missense probably null 0.03
IGL00401:Usp46 APN 5 74003171 missense probably damaging 1.00
IGL00949:Usp46 APN 5 74003242 missense possibly damaging 0.67
IGL02108:Usp46 APN 5 74029206 missense probably damaging 1.00
IGL02325:Usp46 APN 5 74037028 splice site probably null
IGL02383:Usp46 APN 5 74029353 missense probably benign 0.22
IGL02400:Usp46 APN 5 74037052 missense probably benign 0.00
IGL02833:Usp46 APN 5 74016682 missense probably benign 0.01
R0091:Usp46 UTSW 5 74003257 missense probably benign 0.25
R1714:Usp46 UTSW 5 74003167 missense probably benign 0.35
R4023:Usp46 UTSW 5 74032475 missense probably damaging 1.00
R4051:Usp46 UTSW 5 74002755 missense probably benign 0.01
R4239:Usp46 UTSW 5 74032267 unclassified probably benign
R4240:Usp46 UTSW 5 74032267 unclassified probably benign
R5542:Usp46 UTSW 5 74029241 missense probably benign 0.03
R5907:Usp46 UTSW 5 74037085 missense probably benign 0.05
R6442:Usp46 UTSW 5 74016716 missense probably benign 0.01
R6770:Usp46 UTSW 5 74032354 missense probably benign 0.00
R6856:Usp46 UTSW 5 74028934 unclassified probably benign
R7080:Usp46 UTSW 5 74016683 missense probably benign 0.31
R7430:Usp46 UTSW 5 74003188 missense probably damaging 1.00
R7475:Usp46 UTSW 5 74028937 nonsense probably null
R7782:Usp46 UTSW 5 74002111 missense probably benign 0.00
R8171:Usp46 UTSW 5 74002693 missense probably benign 0.04
R8695:Usp46 UTSW 5 74029236 missense probably benign 0.01
R9262:Usp46 UTSW 5 74029304 missense probably benign 0.07
R9302:Usp46 UTSW 5 74003261 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAACCACGGCTCTAGTGCTTG -3'
(R):5'- AGACCTGAGGTTATTCACAGACCCC -3'

Sequencing Primer
(F):5'- CTCGCACTCCACCAAGTTAT -3'
(R):5'- TCCTAAGTGTCTCAAAGGGC -3'
Posted On 2014-01-15