Mutagenetix > Incidental Mutation

Incidental Mutation 'R1186:P2rx7'

102108

Institutional Source

Beutler Lab

Gene Symbol

P2rx7

Ensembl Gene

ENSMUSG00000029468

Gene Name

purinergic receptor P2X, ligand-gated ion channel, 7

Synonyms

P2X7R, P2X7 receptor, P2X(7)

MMRRC Submission

039258-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1186 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122643911-122691432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122670451 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 299 (Y299H)

Ref Sequence

ENSEMBL: ENSMUSP00000112440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031425] [ENSMUST00000100737] [ENSMUST00000121489]

AlphaFold

Q9Z1M0

Predicted Effect

probably damaging
Transcript: ENSMUST00000031425
AA Change: Y299H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031425
Gene: ENSMUSG00000029468
AA Change: Y299H

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	403	1e-149	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000100737
AA Change: Y299H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098303
Gene: ENSMUSG00000029468
AA Change: Y299H

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	397	3.6e-158	PFAM
low complexity region	435	451	N/A	INTRINSIC
low complexity region	516	536	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121489
AA Change: Y299H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112440
Gene: ENSMUSG00000029468
AA Change: Y299H

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	403	3.5e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199371

Meta Mutation Damage Score

0.5037

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 95.7%
20x: 90.1%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and viable with no obvious phenotypic abnormality. Cellular responses of macrophages to extracellular ATP are frequently normal however. In addition, long bones are thinner than normal in adult mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	G	A	10: 21,621,652	R64Q	probably benign	Het
4932438A13Rik	T	C	3: 36,996,312		probably benign	Het
9530068E07Rik	G	A	11: 52,403,078	V49I	probably benign	Het
A2m	T	C	6: 121,661,534	S902P	probably benign	Het
Aatf	A	T	11: 84,470,549		probably benign	Het
Adamtsl1	A	G	4: 86,388,509	T1395A	probably benign	Het
Alpk2	T	C	18: 65,294,341		probably null	Het
Ank3	G	T	10: 69,867,460	A308S	probably damaging	Het
Arap1	A	G	7: 101,404,269		probably benign	Het
C4b	T	C	17: 34,736,309	D769G	possibly damaging	Het
Cep350	A	G	1: 155,875,376	S2017P	probably damaging	Het
Cfap54	T	A	10: 92,875,994	I2704F	unknown	Het
Crip2	G	A	12: 113,144,959		probably benign	Het
Cyp4f14	T	C	17: 32,916,786	I34V	probably benign	Het
Dcstamp	A	G	15: 39,754,629		probably null	Het
Ddx5	T	C	11: 106,783,979		probably null	Het
Dnah2	A	T	11: 69,515,700	L572Q	probably damaging	Het
Espl1	G	A	15: 102,304,039	A527T	probably benign	Het
Fam83d	A	G	2: 158,785,174	D261G	probably damaging	Het
Fbxo34	T	C	14: 47,530,586	F468L	probably damaging	Het
Gabarapl1	A	T	6: 129,533,405		probably benign	Het
Galnt17	G	T	5: 131,111,742	T179K	probably damaging	Het
Gm6768	A	C	12: 119,261,471		noncoding transcript	Het
Gm6899	C	T	11: 26,593,685		probably benign	Het
Helz2	T	A	2: 181,231,128	R2433W	probably damaging	Het
Hivep3	T	C	4: 119,814,723		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ica1	A	G	6: 8,672,326	L225P	probably damaging	Het
Inpp5f	T	C	7: 128,694,583	I195T	probably benign	Het
Isyna1	C	A	8: 70,595,201	N115K	probably benign	Het
Ly6g6e	T	C	17: 35,078,008	F75S	probably benign	Het
Ly96	A	G	1: 16,700,894	D101G	possibly damaging	Het
Mapk9	A	G	11: 49,878,269	T243A	probably damaging	Het
Mcc	A	G	18: 44,759,403	V48A	probably benign	Het
Mcpt2	C	T	14: 56,043,945		probably benign	Het
Med24	T	C	11: 98,717,757		probably benign	Het
Mtbp	G	A	15: 55,564,671	G162S	probably null	Het
Mtfr2	G	A	10: 20,352,852	C48Y	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Naip2	AGGG	AGG	13: 100,162,037		probably null	Het
Nup107	A	C	10: 117,777,146	Y292*	probably null	Het
Nwd2	C	T	5: 63,650,024		probably benign	Het
Nxpe4	A	C	9: 48,393,392	N260H	probably benign	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1084	A	T	2: 86,639,463	L82M	probably damaging	Het
Olfr5	T	C	7: 6,480,542	I205V	probably benign	Het
Olfr901	T	C	9: 38,431,101	V273A	possibly damaging	Het
Olfr911-ps1	T	C	9: 38,524,157	S142P	probably damaging	Het
Per3	T	A	4: 151,026,138	E401V	probably damaging	Het
Rbm34	C	A	8: 126,965,447	E182*	probably null	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Senp2	T	C	16: 22,011,504	S38P	probably damaging	Het
Slc36a2	A	T	11: 55,164,231		probably null	Het
Spred1	A	T	2: 117,177,697	R361S	possibly damaging	Het
Spry2	A	G	14: 105,892,907	C282R	probably damaging	Het
Srp54b	T	C	12: 55,255,528		probably benign	Het
Taar8c	G	C	10: 24,101,565	Y116*	probably null	Het
Tchh	C	G	3: 93,448,046	R1598G	unknown	Het
Tex15	A	G	8: 33,571,633	M364V	probably benign	Het
Ttbk1	T	C	17: 46,467,131	R662G	probably damaging	Het
Ttc5	G	A	14: 50,767,226	Q374*	probably null	Het
Usp46	C	T	5: 74,002,122	A312T	probably benign	Het
Vmn1r176	A	T	7: 23,835,626	L34Q	probably damaging	Het
Vmn1r178	A	T	7: 23,893,892	R122*	probably null	Het
Vmn2r6	T	A	3: 64,565,067	M78L	probably benign	Het
Zfp407	A	T	18: 84,209,448	I2012N	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het
Zfyve26	G	A	12: 79,263,949	L161F	probably damaging	Het

Other mutations in P2rx7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01534:P2rx7	APN	5	122676698	missense	probably damaging	1.00
IGL01911:P2rx7	APN	5	122658768	missense	probably damaging	0.99
IGL02375:P2rx7	APN	5	122673656	splice site	probably benign
IGL02502:P2rx7	APN	5	122680987	missense	possibly damaging	0.92
IGL03102:P2rx7	APN	5	122663605	missense	possibly damaging	0.88
IGL03179:P2rx7	APN	5	122673700	missense	possibly damaging	0.66
ailing	UTSW	5	122673736	missense	probably benign
Enfermo	UTSW	5	122652789	missense	probably damaging	0.98
Incapacitated	UTSW	5	122673793	missense	probably damaging	0.99
Sickpuppy	UTSW	5	122681003	missense	probably damaging	0.96
Stumped	UTSW	5	122652726	critical splice acceptor site	probably null
BB009:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
BB019:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
PIT1430001:P2rx7	UTSW	5	122681216	missense	probably damaging	0.99
R0363:P2rx7	UTSW	5	122657030	nonsense	probably null
R0558:P2rx7	UTSW	5	122673798	missense	possibly damaging	0.83
R1709:P2rx7	UTSW	5	122670465	missense	possibly damaging	0.95
R1856:P2rx7	UTSW	5	122681032	missense	probably damaging	1.00
R1899:P2rx7	UTSW	5	122673736	missense	probably benign
R1905:P2rx7	UTSW	5	122680952	missense	probably damaging	1.00
R2082:P2rx7	UTSW	5	122644095	missense	possibly damaging	0.92
R2117:P2rx7	UTSW	5	122681266	missense	probably benign	0.00
R2205:P2rx7	UTSW	5	122681101	missense	probably damaging	1.00
R2446:P2rx7	UTSW	5	122680816	missense	probably benign
R3151:P2rx7	UTSW	5	122681266	missense	probably benign	0.00
R4052:P2rx7	UTSW	5	122666277	missense	probably damaging	1.00
R4883:P2rx7	UTSW	5	122681066	missense	probably damaging	1.00
R4930:P2rx7	UTSW	5	122670479	missense	probably damaging	1.00
R5194:P2rx7	UTSW	5	122673795	missense	probably benign	0.00
R5257:P2rx7	UTSW	5	122681003	missense	probably damaging	0.96
R5258:P2rx7	UTSW	5	122681003	missense	probably damaging	0.96
R5481:P2rx7	UTSW	5	122680820	missense	possibly damaging	0.89
R5656:P2rx7	UTSW	5	122673717	missense	probably damaging	0.99
R5738:P2rx7	UTSW	5	122652789	missense	probably damaging	0.98
R6587:P2rx7	UTSW	5	122664550	missense	probably damaging	1.00
R7098:P2rx7	UTSW	5	122673793	missense	probably damaging	0.99
R7120:P2rx7	UTSW	5	122681294	missense	probably benign
R7180:P2rx7	UTSW	5	122680820	missense	possibly damaging	0.89
R7358:P2rx7	UTSW	5	122666142	critical splice acceptor site	probably null
R7724:P2rx7	UTSW	5	122673373	missense	probably benign	0.07
R7932:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
R8240:P2rx7	UTSW	5	122655033	missense	probably damaging	1.00
R8425:P2rx7	UTSW	5	122670458	missense	probably damaging	0.96
R9140:P2rx7	UTSW	5	122652726	critical splice acceptor site	probably null
R9331:P2rx7	UTSW	5	122680898	missense	probably benign	0.01
R9623:P2rx7	UTSW	5	122652797	missense	probably damaging	1.00
Z1177:P2rx7	UTSW	5	122663641	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAGCTACTCAGACCTTCCGAAAC -3'
(R):5'- AGCCAATGACTGACAGCTACTGC -3'

Sequencing Primer
(F):5'- CAGAGGCCCCTTTTTTGAATAG -3'
(R):5'- ACTGACAGCTACTGCTAGTGTTC -3'

Posted On

2014-01-15