Incidental Mutation 'R1186:P2rx7'
ID 102108
Institutional Source Beutler Lab
Gene Symbol P2rx7
Ensembl Gene ENSMUSG00000029468
Gene Name purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms P2X7R, P2X7 receptor, P2X(7)
MMRRC Submission 039258-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1186 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 122643911-122691432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122670451 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 299 (Y299H)
Ref Sequence ENSEMBL: ENSMUSP00000112440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031425] [ENSMUST00000100737] [ENSMUST00000121489]
AlphaFold Q9Z1M0
Predicted Effect probably damaging
Transcript: ENSMUST00000031425
AA Change: Y299H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031425
Gene: ENSMUSG00000029468
AA Change: Y299H

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 403 1e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100737
AA Change: Y299H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098303
Gene: ENSMUSG00000029468
AA Change: Y299H

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 397 3.6e-158 PFAM
low complexity region 435 451 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121489
AA Change: Y299H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112440
Gene: ENSMUSG00000029468
AA Change: Y299H

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 403 3.5e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199371
Meta Mutation Damage Score 0.5037 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and viable with no obvious phenotypic abnormality. Cellular responses of macrophages to extracellular ATP are frequently normal however. In addition, long bones are thinner than normal in adult mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Alpk2 T C 18: 65,294,341 probably null Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Ddx5 T C 11: 106,783,979 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Galnt17 G T 5: 131,111,742 T179K probably damaging Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Inpp5f T C 7: 128,694,583 I195T probably benign Het
Isyna1 C A 8: 70,595,201 N115K probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Med24 T C 11: 98,717,757 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1084 A T 2: 86,639,463 L82M probably damaging Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Senp2 T C 16: 22,011,504 S38P probably damaging Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Spry2 A G 14: 105,892,907 C282R probably damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Usp46 C T 5: 74,002,122 A312T probably benign Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Vmn2r6 T A 3: 64,565,067 M78L probably benign Het
Zfp407 A T 18: 84,209,448 I2012N probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in P2rx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:P2rx7 APN 5 122676698 missense probably damaging 1.00
IGL01911:P2rx7 APN 5 122658768 missense probably damaging 0.99
IGL02375:P2rx7 APN 5 122673656 splice site probably benign
IGL02502:P2rx7 APN 5 122680987 missense possibly damaging 0.92
IGL03102:P2rx7 APN 5 122663605 missense possibly damaging 0.88
IGL03179:P2rx7 APN 5 122673700 missense possibly damaging 0.66
ailing UTSW 5 122673736 missense probably benign
Enfermo UTSW 5 122652789 missense probably damaging 0.98
Incapacitated UTSW 5 122673793 missense probably damaging 0.99
Sickpuppy UTSW 5 122681003 missense probably damaging 0.96
BB009:P2rx7 UTSW 5 122644182 missense probably benign 0.01
BB019:P2rx7 UTSW 5 122644182 missense probably benign 0.01
PIT1430001:P2rx7 UTSW 5 122681216 missense probably damaging 0.99
R0363:P2rx7 UTSW 5 122657030 nonsense probably null
R0558:P2rx7 UTSW 5 122673798 missense possibly damaging 0.83
R1709:P2rx7 UTSW 5 122670465 missense possibly damaging 0.95
R1856:P2rx7 UTSW 5 122681032 missense probably damaging 1.00
R1899:P2rx7 UTSW 5 122673736 missense probably benign
R1905:P2rx7 UTSW 5 122680952 missense probably damaging 1.00
R2082:P2rx7 UTSW 5 122644095 missense possibly damaging 0.92
R2117:P2rx7 UTSW 5 122681266 missense probably benign 0.00
R2205:P2rx7 UTSW 5 122681101 missense probably damaging 1.00
R2446:P2rx7 UTSW 5 122680816 missense probably benign
R3151:P2rx7 UTSW 5 122681266 missense probably benign 0.00
R4052:P2rx7 UTSW 5 122666277 missense probably damaging 1.00
R4883:P2rx7 UTSW 5 122681066 missense probably damaging 1.00
R4930:P2rx7 UTSW 5 122670479 missense probably damaging 1.00
R5194:P2rx7 UTSW 5 122673795 missense probably benign 0.00
R5257:P2rx7 UTSW 5 122681003 missense probably damaging 0.96
R5258:P2rx7 UTSW 5 122681003 missense probably damaging 0.96
R5481:P2rx7 UTSW 5 122680820 missense possibly damaging 0.89
R5656:P2rx7 UTSW 5 122673717 missense probably damaging 0.99
R5738:P2rx7 UTSW 5 122652789 missense probably damaging 0.98
R6587:P2rx7 UTSW 5 122664550 missense probably damaging 1.00
R7098:P2rx7 UTSW 5 122673793 missense probably damaging 0.99
R7120:P2rx7 UTSW 5 122681294 missense probably benign
R7180:P2rx7 UTSW 5 122680820 missense possibly damaging 0.89
R7358:P2rx7 UTSW 5 122666142 critical splice acceptor site probably null
R7724:P2rx7 UTSW 5 122673373 missense probably benign 0.07
R7932:P2rx7 UTSW 5 122644182 missense probably benign 0.01
R8240:P2rx7 UTSW 5 122655033 missense probably damaging 1.00
R8425:P2rx7 UTSW 5 122670458 missense probably damaging 0.96
R9140:P2rx7 UTSW 5 122652726 critical splice acceptor site probably null
R9331:P2rx7 UTSW 5 122680898 missense probably benign 0.01
Z1177:P2rx7 UTSW 5 122663641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGCTACTCAGACCTTCCGAAAC -3'
(R):5'- AGCCAATGACTGACAGCTACTGC -3'

Sequencing Primer
(F):5'- CAGAGGCCCCTTTTTTGAATAG -3'
(R):5'- ACTGACAGCTACTGCTAGTGTTC -3'
Posted On 2014-01-15