Incidental Mutation 'R1186:Galnt17'
ID 102110
Institutional Source Beutler Lab
Gene Symbol Galnt17
Ensembl Gene ENSMUSG00000034040
Gene Name polypeptide N-acetylgalactosaminyltransferase 17
Synonyms E330012B09Rik, Wbscr17, Galnt19, Gcap8
MMRRC Submission 039258-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1186 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 130872082-131308497 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 131111742 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 179 (T179K)
Ref Sequence ENSEMBL: ENSMUSP00000083187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086023] [ENSMUST00000160609]
AlphaFold Q7TT15
Predicted Effect probably damaging
Transcript: ENSMUST00000086023
AA Change: T179K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083187
Gene: ENSMUSG00000034040
AA Change: T179K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glycos_transf_2 155 341 9.6e-31 PFAM
Pfam:Glyco_tranf_2_2 155 394 7.8e-8 PFAM
RICIN 465 594 9.77e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160609
AA Change: T179K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125395
Gene: ENSMUSG00000034040
AA Change: T179K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glycos_transf_2 155 341 4.9e-29 PFAM
Pfam:Glyco_tranf_2_2 155 367 3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160807
Meta Mutation Damage Score 0.9160 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N-acetylgalactosaminyltransferase. This gene is located centromeric to the common deleted region in Williams-Beuren syndrome (WBS), a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. This protein may play a role in membrane trafficking. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Alpk2 T C 18: 65,294,341 probably null Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Ddx5 T C 11: 106,783,979 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Inpp5f T C 7: 128,694,583 I195T probably benign Het
Isyna1 C A 8: 70,595,201 N115K probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Med24 T C 11: 98,717,757 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1084 A T 2: 86,639,463 L82M probably damaging Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
P2rx7 T C 5: 122,670,451 Y299H probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Senp2 T C 16: 22,011,504 S38P probably damaging Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Spry2 A G 14: 105,892,907 C282R probably damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Usp46 C T 5: 74,002,122 A312T probably benign Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Vmn2r6 T A 3: 64,565,067 M78L probably benign Het
Zfp407 A T 18: 84,209,448 I2012N probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in Galnt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Galnt17 APN 5 131085896 critical splice donor site probably null
IGL02312:Galnt17 APN 5 131306533 missense probably benign 0.09
IGL02744:Galnt17 APN 5 131111775 missense probably damaging 0.99
IGL03066:Galnt17 APN 5 130900648 missense probably benign
R0744:Galnt17 UTSW 5 131150916 missense probably damaging 1.00
R1784:Galnt17 UTSW 5 131150963 missense probably benign 0.35
R1909:Galnt17 UTSW 5 131111838 missense probably benign 0.03
R1969:Galnt17 UTSW 5 131150944 missense probably benign 0.19
R2102:Galnt17 UTSW 5 131085993 missense probably damaging 1.00
R2158:Galnt17 UTSW 5 130906702 missense probably damaging 1.00
R2307:Galnt17 UTSW 5 130900622 missense probably damaging 1.00
R2680:Galnt17 UTSW 5 131111823 missense probably damaging 0.97
R4549:Galnt17 UTSW 5 131150937 missense probably damaging 1.00
R4938:Galnt17 UTSW 5 131306399 missense probably benign
R5030:Galnt17 UTSW 5 130876513 missense probably damaging 0.98
R5134:Galnt17 UTSW 5 130964035 missense probably damaging 1.00
R5499:Galnt17 UTSW 5 130900628 missense probably benign 0.28
R5518:Galnt17 UTSW 5 130900590 missense probably damaging 1.00
R5662:Galnt17 UTSW 5 131086006 missense probably damaging 1.00
R5806:Galnt17 UTSW 5 130877819 missense probably damaging 1.00
R6209:Galnt17 UTSW 5 131081596 missense probably benign 0.01
R6751:Galnt17 UTSW 5 131081590 missense probably damaging 0.99
R7205:Galnt17 UTSW 5 131306752 start gained probably benign
R7212:Galnt17 UTSW 5 130964111 missense possibly damaging 0.69
R7529:Galnt17 UTSW 5 131306380 missense probably damaging 0.99
R8881:Galnt17 UTSW 5 130877797 missense probably benign 0.05
R8976:Galnt17 UTSW 5 130906705 missense probably benign 0.01
R9480:Galnt17 UTSW 5 130906738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCCAATATGTTCCAGGGAGCC -3'
(R):5'- CAAGGGAGAGTGATGAATCCTTGCC -3'

Sequencing Primer
(F):5'- TATGTTCCAGGGAGCCAAAGAC -3'
(R):5'- agtcatctctccagcccc -3'
Posted On 2014-01-15