Mutagenetix > Incidental Mutations

Incidental Mutation 'R1186:A2m'

102114

Institutional Source

Beutler Lab

Gene Symbol

A2m

Ensembl Gene

ENSMUSG00000030111

Gene Name

alpha-2-macroglobulin

Synonyms

A2mp

MMRRC Submission

039258-MU

Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1186 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121635376-121679227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121661534 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 902 (S902P)

Ref Sequence

ENSEMBL: ENSMUSP00000032203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032203]

Predicted Effect

probably benign
Transcript: ENSMUST00000032203
AA Change: S902P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: S902P

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:A2M_N	134	227	2.1e-20	PFAM
low complexity region	334	347	N/A	INTRINSIC
A2M_N_2	465	613	2.04e-31	SMART
low complexity region	722	731	N/A	INTRINSIC
A2M	738	828	2.31e-39	SMART
Pfam:Thiol-ester_cl	961	990	4.4e-18	PFAM
Pfam:A2M_comp	1010	1266	1.4e-98	PFAM
A2M_recep	1376	1463	2.69e-40	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203413

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 95.7%
20x: 90.1%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	G	A	10: 21,621,652	R64Q	probably benign	Het
4932438A13Rik	T	C	3: 36,996,312		probably benign	Het
9530068E07Rik	G	A	11: 52,403,078	V49I	probably benign	Het
Aatf	A	T	11: 84,470,549		probably benign	Het
Adamtsl1	A	G	4: 86,388,509	T1395A	probably benign	Het
Alpk2	T	C	18: 65,294,341		probably null	Het
Ank3	G	T	10: 69,867,460	A308S	probably damaging	Het
Arap1	A	G	7: 101,404,269		probably benign	Het
C4b	T	C	17: 34,736,309	D769G	possibly damaging	Het
Cep350	A	G	1: 155,875,376	S2017P	probably damaging	Het
Cfap54	T	A	10: 92,875,994	I2704F	unknown	Het
Crip2	G	A	12: 113,144,959		probably benign	Het
Cyp4f14	T	C	17: 32,916,786	I34V	probably benign	Het
Dcstamp	A	G	15: 39,754,629		probably null	Het
Ddx5	T	C	11: 106,783,979		probably null	Het
Dnah2	A	T	11: 69,515,700	L572Q	probably damaging	Het
Espl1	G	A	15: 102,304,039	A527T	probably benign	Het
Fam83d	A	G	2: 158,785,174	D261G	probably damaging	Het
Fbxo34	T	C	14: 47,530,586	F468L	probably damaging	Het
Gabarapl1	A	T	6: 129,533,405		probably benign	Het
Galnt17	G	T	5: 131,111,742	T179K	probably damaging	Het
Gm6768	A	C	12: 119,261,471		noncoding transcript	Het
Gm6899	C	T	11: 26,593,685		probably benign	Het
Helz2	T	A	2: 181,231,128	R2433W	probably damaging	Het
Hivep3	T	C	4: 119,814,723		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ica1	A	G	6: 8,672,326	L225P	probably damaging	Het
Inpp5f	T	C	7: 128,694,583	I195T	probably benign	Het
Isyna1	C	A	8: 70,595,201	N115K	probably benign	Het
Ly6g6e	T	C	17: 35,078,008	F75S	probably benign	Het
Ly96	A	G	1: 16,700,894	D101G	possibly damaging	Het
Mapk9	A	G	11: 49,878,269	T243A	probably damaging	Het
Mcc	A	G	18: 44,759,403	V48A	probably benign	Het
Mcpt2	C	T	14: 56,043,945		probably benign	Het
Med24	T	C	11: 98,717,757		probably benign	Het
Mtbp	G	A	15: 55,564,671	G162S	probably null	Het
Mtfr2	G	A	10: 20,352,852	C48Y	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Naip2	AGGG	AGG	13: 100,162,037		probably null	Het
Nup107	A	C	10: 117,777,146	Y292*	probably null	Het
Nwd2	C	T	5: 63,650,024		probably benign	Het
Nxpe4	A	C	9: 48,393,392	N260H	probably benign	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1084	A	T	2: 86,639,463	L82M	probably damaging	Het
Olfr5	T	C	7: 6,480,542	I205V	probably benign	Het
Olfr901	T	C	9: 38,431,101	V273A	possibly damaging	Het
Olfr911-ps1	T	C	9: 38,524,157	S142P	probably damaging	Het
P2rx7	T	C	5: 122,670,451	Y299H	probably damaging	Het
Per3	T	A	4: 151,026,138	E401V	probably damaging	Het
Rbm34	C	A	8: 126,965,447	E182*	probably null	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Senp2	T	C	16: 22,011,504	S38P	probably damaging	Het
Slc36a2	A	T	11: 55,164,231		probably null	Het
Spred1	A	T	2: 117,177,697	R361S	possibly damaging	Het
Spry2	A	G	14: 105,892,907	C282R	probably damaging	Het
Srp54b	T	C	12: 55,255,528		probably benign	Het
Taar8c	G	C	10: 24,101,565	Y116*	probably null	Het
Tchh	C	G	3: 93,448,046	R1598G	unknown	Het
Tex15	A	G	8: 33,571,633	M364V	probably benign	Het
Ttbk1	T	C	17: 46,467,131	R662G	probably damaging	Het
Ttc5	G	A	14: 50,767,226	Q374*	probably null	Het
Usp46	C	T	5: 74,002,122	A312T	probably benign	Het
Vmn1r176	A	T	7: 23,835,626	L34Q	probably damaging	Het
Vmn1r178	A	T	7: 23,893,892	R122*	probably null	Het
Vmn2r6	T	A	3: 64,565,067	M78L	probably benign	Het
Zfp407	A	T	18: 84,209,448	I2012N	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het
Zfyve26	G	A	12: 79,263,949	L161F	probably damaging	Het

Other mutations in A2m

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:A2m	APN	6	121644149	missense	possibly damaging	0.67
IGL00798:A2m	APN	6	121671010	missense	probably damaging	1.00
IGL01154:A2m	APN	6	121673542	nonsense	probably null
IGL01313:A2m	APN	6	121645010	critical splice donor site	probably null
IGL01337:A2m	APN	6	121668570	missense	probably damaging	0.98
IGL01505:A2m	APN	6	121676947	missense	possibly damaging	0.83
IGL01508:A2m	APN	6	121659367	nonsense	probably null
IGL01672:A2m	APN	6	121641357	missense	probably damaging	1.00
IGL01951:A2m	APN	6	121667190	missense	possibly damaging	0.78
IGL02012:A2m	APN	6	121674861	missense	probably damaging	1.00
IGL02066:A2m	APN	6	121649895	missense	probably damaging	1.00
IGL02234:A2m	APN	6	121668220	missense	possibly damaging	0.67
IGL02397:A2m	APN	6	121646875	missense	probably benign
IGL02407:A2m	APN	6	121668616	nonsense	probably null
IGL02408:A2m	APN	6	121644171	missense	probably damaging	0.99
IGL02469:A2m	APN	6	121668115	missense	probably damaging	1.00
IGL02527:A2m	APN	6	121661433	missense	probably damaging	0.99
IGL02612:A2m	APN	6	121678012	missense	probably benign
IGL02746:A2m	APN	6	121669503	splice site	probably benign
IGL02952:A2m	APN	6	121678025	missense	probably damaging	0.99
IGL03056:A2m	APN	6	121670903	missense	probably damaging	0.96
IGL03121:A2m	APN	6	121641306	missense	probably benign	0.02
IGL03303:A2m	APN	6	121667163	missense	probably damaging	1.00
IGL03369:A2m	APN	6	121676903	critical splice acceptor site	probably null
IGL03046:A2m	UTSW	6	121659323	missense	probably benign	0.04
R0040:A2m	UTSW	6	121645206	missense	possibly damaging	0.93
R0049:A2m	UTSW	6	121638308	missense	possibly damaging	0.77
R0049:A2m	UTSW	6	121638308	missense	possibly damaging	0.77
R0109:A2m	UTSW	6	121659303	missense	probably benign	0.00
R0147:A2m	UTSW	6	121662446	critical splice donor site	probably null
R0148:A2m	UTSW	6	121662446	critical splice donor site	probably null
R0345:A2m	UTSW	6	121638272	splice site	probably benign
R0445:A2m	UTSW	6	121657955	missense	probably damaging	1.00
R0766:A2m	UTSW	6	121676890	splice site	probably benign
R1436:A2m	UTSW	6	121644213	missense	probably benign	0.09
R1452:A2m	UTSW	6	121678056	missense	probably benign	0.01
R1636:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1637:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1638:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1698:A2m	UTSW	6	121645158	missense	possibly damaging	0.88
R1776:A2m	UTSW	6	121641424	missense	probably damaging	1.00
R1791:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1918:A2m	UTSW	6	121644936	missense	probably benign	0.16
R1921:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1927:A2m	UTSW	6	121636379	missense	probably damaging	1.00
R1934:A2m	UTSW	6	121649833	missense	probably damaging	0.98
R1943:A2m	UTSW	6	121668547	missense	possibly damaging	0.90
R1996:A2m	UTSW	6	121669597	missense	probably damaging	1.00
R2039:A2m	UTSW	6	121659949	missense	probably benign	0.32
R2085:A2m	UTSW	6	121676959	missense	probably damaging	1.00
R2092:A2m	UTSW	6	121674937	nonsense	probably null
R2105:A2m	UTSW	6	121673500	missense	probably benign	0.04
R2107:A2m	UTSW	6	121654612	missense	probably benign	0.04
R2235:A2m	UTSW	6	121642064	missense	probably benign	0.21
R2292:A2m	UTSW	6	121673559	missense	possibly damaging	0.90
R2350:A2m	UTSW	6	121678088	splice site	probably benign
R3001:A2m	UTSW	6	121661447	missense	possibly damaging	0.88
R3002:A2m	UTSW	6	121661447	missense	possibly damaging	0.88
R3023:A2m	UTSW	6	121669572	missense	probably benign	0.08
R3429:A2m	UTSW	6	121636290	start codon destroyed	probably null
R3437:A2m	UTSW	6	121639294	missense	probably null	0.03
R3909:A2m	UTSW	6	121648166	missense	probably damaging	1.00
R4300:A2m	UTSW	6	121673475	missense	probably benign	0.00
R4332:A2m	UTSW	6	121657447	missense	probably benign	0.01
R4584:A2m	UTSW	6	121657406	missense	probably benign	0.07
R4697:A2m	UTSW	6	121638284	start codon destroyed	probably null	0.94
R4710:A2m	UTSW	6	121641303	missense	probably benign	0.03
R4841:A2m	UTSW	6	121646844	missense	probably benign	0.06
R5206:A2m	UTSW	6	121674807	missense	probably damaging	1.00
R5219:A2m	UTSW	6	121676950	missense	possibly damaging	0.90
R5230:A2m	UTSW	6	121674861	missense	probably damaging	1.00
R5330:A2m	UTSW	6	121638416	missense	probably benign	0.11
R5331:A2m	UTSW	6	121638416	missense	probably benign	0.11
R5377:A2m	UTSW	6	121645253	missense	probably benign
R5590:A2m	UTSW	6	121676932	missense	probably damaging	1.00
R5835:A2m	UTSW	6	121639336	missense	probably damaging	1.00
R5910:A2m	UTSW	6	121668117	missense	probably damaging	1.00
R5915:A2m	UTSW	6	121667163	missense	probably damaging	1.00
R5949:A2m	UTSW	6	121678073	missense	probably damaging	1.00
R5994:A2m	UTSW	6	121670903	missense	probably benign	0.38
R5996:A2m	UTSW	6	121659394	missense	probably damaging	1.00
R6035:A2m	UTSW	6	121638394	missense	probably damaging	0.99
R6035:A2m	UTSW	6	121638394	missense	probably damaging	0.99
R6090:A2m	UTSW	6	121648013	missense	probably benign	0.45
R6241:A2m	UTSW	6	121646829	missense	probably benign	0.09
R6294:A2m	UTSW	6	121654481	missense	probably benign
R6492:A2m	UTSW	6	121654505	missense	probably benign	0.35
R6554:A2m	UTSW	6	121641287	missense	probably damaging	1.00
R6597:A2m	UTSW	6	121648121	missense	probably damaging	1.00
R6742:A2m	UTSW	6	121678036	missense	probably benign	0.01
R6795:A2m	UTSW	6	121648322	splice site	probably null
R6843:A2m	UTSW	6	121638401	missense	probably benign	0.01
R7013:A2m	UTSW	6	121641386	missense	probably null	0.00
R7137:A2m	UTSW	6	121677985	missense	possibly damaging	0.85
R7167:A2m	UTSW	6	121647971	missense	probably benign
R7294:A2m	UTSW	6	121673582	nonsense	probably null
R7452:A2m	UTSW	6	121641332	missense	probably damaging	1.00
R7507:A2m	UTSW	6	121675218	missense	probably benign	0.01
R7602:A2m	UTSW	6	121642007	missense	probably damaging	1.00
R7602:A2m	UTSW	6	121670936	missense	possibly damaging	0.79
R7709:A2m	UTSW	6	121660104	missense	possibly damaging	0.81
R7766:A2m	UTSW	6	121638341	missense	probably benign	0.08
R7921:A2m	UTSW	6	121677995	missense	probably benign	0.00
R8007:A2m	UTSW	6	121670886	intron	probably benign
R8291:A2m	UTSW	6	121678058	missense	probably damaging	1.00
X0057:A2m	UTSW	6	121668176	missense	probably damaging	1.00
X0060:A2m	UTSW	6	121676080	missense	probably damaging	1.00
X0063:A2m	UTSW	6	121646876	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCTTACCTCCACTTCTAGTGACACAG -3'
(R):5'- GGGGACCACAGAGTCCCACA -3'

Sequencing Primer
(F):5'- CTAGTGACACAGATCTCTAGTGG -3'
(R):5'- gataaatgatagaCGACAGAGAGATG -3'

Posted On

2014-01-15