Mutagenetix > Incidental Mutations

Incidental Mutation 'R1186:Arap1'

102124

Institutional Source

Beutler Lab

Gene Symbol

Arap1

Ensembl Gene

ENSMUSG00000032812

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1

Synonyms

Centd2, 2410002L19Rik

MMRRC Submission

039258-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1186 (G1)

Quality Score

194

Status

Validated

Chromosome

Chromosomal Location

101348067-101412586 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 101404269 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000102624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084895] [ENSMUST00000084896] [ENSMUST00000098243] [ENSMUST00000107010]

Predicted Effect

probably benign
Transcript: ENSMUST00000084895

SMART Domains

Protein: ENSMUSP00000081957
Gene: ENSMUSG00000032812

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC
PH	82	175	2.62e-17	SMART
PH	195	285	3.6e-6	SMART
ArfGap	289	415	2.4e-22	SMART
PH	498	606	1.23e-13	SMART
PH	616	710	1.08e0	SMART
RhoGAP	722	904	1.35e-63	SMART
Pfam:RA	926	1015	1.5e-10	PFAM
PH	1029	1141	8.58e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084896

SMART Domains

Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812

Domain	Start	End	E-Value	Type
SAM	3	70	1.72e-7	SMART
low complexity region	92	104	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	151	167	N/A	INTRINSIC
low complexity region	197	227	N/A	INTRINSIC
low complexity region	267	285	N/A	INTRINSIC
PH	330	423	2.62e-17	SMART
PH	443	533	3.6e-6	SMART
ArfGap	537	663	2.4e-22	SMART
PH	746	854	1.23e-13	SMART
PH	864	958	1.08e0	SMART
RhoGAP	970	1152	1.35e-63	SMART
Pfam:RA	1174	1263	6.6e-13	PFAM
PH	1277	1400	8e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000098243

SMART Domains

Protein: ENSMUSP00000095844
Gene: ENSMUSG00000032812

Domain	Start	End	E-Value	Type
PH	32	140	1.23e-13	SMART
PH	150	244	1.08e0	SMART
RhoGAP	256	438	1.35e-63	SMART
Pfam:RA	460	549	1.2e-11	PFAM
PH	563	675	8.58e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107010

SMART Domains

Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812

Domain	Start	End	E-Value	Type
SAM	3	70	1.72e-7	SMART
low complexity region	92	104	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	151	167	N/A	INTRINSIC
low complexity region	197	227	N/A	INTRINSIC
low complexity region	267	285	N/A	INTRINSIC
PH	330	423	2.62e-17	SMART
PH	443	533	3.6e-6	SMART
ArfGap	537	663	2.4e-22	SMART
PH	746	854	1.23e-13	SMART
PH	864	958	1.08e0	SMART
RhoGAP	970	1152	1.35e-63	SMART
Pfam:RA	1174	1263	1.9e-10	PFAM
PH	1277	1389	8.58e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124637

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125284

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156017

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210162

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 95.7%
20x: 90.1%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	G	A	10: 21,621,652	R64Q	probably benign	Het
4932438A13Rik	T	C	3: 36,996,312		probably benign	Het
9530068E07Rik	G	A	11: 52,403,078	V49I	probably benign	Het
A2m	T	C	6: 121,661,534	S902P	probably benign	Het
Aatf	A	T	11: 84,470,549		probably benign	Het
Adamtsl1	A	G	4: 86,388,509	T1395A	probably benign	Het
Alpk2	T	C	18: 65,294,341		probably null	Het
Ank3	G	T	10: 69,867,460	A308S	probably damaging	Het
C4b	T	C	17: 34,736,309	D769G	possibly damaging	Het
Cep350	A	G	1: 155,875,376	S2017P	probably damaging	Het
Cfap54	T	A	10: 92,875,994	I2704F	unknown	Het
Crip2	G	A	12: 113,144,959		probably benign	Het
Cyp4f14	T	C	17: 32,916,786	I34V	probably benign	Het
Dcstamp	A	G	15: 39,754,629		probably null	Het
Ddx5	T	C	11: 106,783,979		probably null	Het
Dnah2	A	T	11: 69,515,700	L572Q	probably damaging	Het
Espl1	G	A	15: 102,304,039	A527T	probably benign	Het
Fam83d	A	G	2: 158,785,174	D261G	probably damaging	Het
Fbxo34	T	C	14: 47,530,586	F468L	probably damaging	Het
Gabarapl1	A	T	6: 129,533,405		probably benign	Het
Galnt17	G	T	5: 131,111,742	T179K	probably damaging	Het
Gm6768	A	C	12: 119,261,471		noncoding transcript	Het
Gm6899	C	T	11: 26,593,685		probably benign	Het
Helz2	T	A	2: 181,231,128	R2433W	probably damaging	Het
Hivep3	T	C	4: 119,814,723		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ica1	A	G	6: 8,672,326	L225P	probably damaging	Het
Inpp5f	T	C	7: 128,694,583	I195T	probably benign	Het
Isyna1	C	A	8: 70,595,201	N115K	probably benign	Het
Ly6g6e	T	C	17: 35,078,008	F75S	probably benign	Het
Ly96	A	G	1: 16,700,894	D101G	possibly damaging	Het
Mapk9	A	G	11: 49,878,269	T243A	probably damaging	Het
Mcc	A	G	18: 44,759,403	V48A	probably benign	Het
Mcpt2	C	T	14: 56,043,945		probably benign	Het
Med24	T	C	11: 98,717,757		probably benign	Het
Mtbp	G	A	15: 55,564,671	G162S	probably null	Het
Mtfr2	G	A	10: 20,352,852	C48Y	probably benign	Het
Naip2	AGGG	AGG	13: 100,162,037		probably null	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Nup107	A	C	10: 117,777,146	Y292*	probably null	Het
Nwd2	C	T	5: 63,650,024		probably benign	Het
Nxpe4	A	C	9: 48,393,392	N260H	probably benign	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1084	A	T	2: 86,639,463	L82M	probably damaging	Het
Olfr5	T	C	7: 6,480,542	I205V	probably benign	Het
Olfr901	T	C	9: 38,431,101	V273A	possibly damaging	Het
Olfr911-ps1	T	C	9: 38,524,157	S142P	probably damaging	Het
P2rx7	T	C	5: 122,670,451	Y299H	probably damaging	Het
Per3	T	A	4: 151,026,138	E401V	probably damaging	Het
Rbm34	C	A	8: 126,965,447	E182*	probably null	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Senp2	T	C	16: 22,011,504	S38P	probably damaging	Het
Slc36a2	A	T	11: 55,164,231		probably null	Het
Spred1	A	T	2: 117,177,697	R361S	possibly damaging	Het
Spry2	A	G	14: 105,892,907	C282R	probably damaging	Het
Srp54b	T	C	12: 55,255,528		probably benign	Het
Taar8c	G	C	10: 24,101,565	Y116*	probably null	Het
Tchh	C	G	3: 93,448,046	R1598G	unknown	Het
Tex15	A	G	8: 33,571,633	M364V	probably benign	Het
Ttbk1	T	C	17: 46,467,131	R662G	probably damaging	Het
Ttc5	G	A	14: 50,767,226	Q374*	probably null	Het
Usp46	C	T	5: 74,002,122	A312T	probably benign	Het
Vmn1r176	A	T	7: 23,835,626	L34Q	probably damaging	Het
Vmn1r178	A	T	7: 23,893,892	R122*	probably null	Het
Vmn2r6	T	A	3: 64,565,067	M78L	probably benign	Het
Zfp407	A	T	18: 84,209,448	I2012N	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het
Zfyve26	G	A	12: 79,263,949	L161F	probably damaging	Het

Other mutations in Arap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Arap1	APN	7	101388049	missense	probably damaging	0.96
IGL01311:Arap1	APN	7	101388136	nonsense	probably null
IGL01349:Arap1	APN	7	101387152	missense	possibly damaging	0.84
IGL01521:Arap1	APN	7	101400605	critical splice donor site	probably null
IGL01869:Arap1	APN	7	101400283	missense	probably damaging	1.00
IGL02156:Arap1	APN	7	101388730	unclassified	probably benign
IGL02320:Arap1	APN	7	101385029	missense	probably benign
IGL02478:Arap1	APN	7	101400125	splice site	probably null
R0133:Arap1	UTSW	7	101386229	missense	probably damaging	0.98
R0233:Arap1	UTSW	7	101400241	missense	possibly damaging	0.47
R0233:Arap1	UTSW	7	101400241	missense	possibly damaging	0.47
R0412:Arap1	UTSW	7	101390222	missense	probably damaging	0.98
R0616:Arap1	UTSW	7	101401650	missense	possibly damaging	0.64
R0838:Arap1	UTSW	7	101400412	missense	probably damaging	1.00
R0962:Arap1	UTSW	7	101384914	missense	possibly damaging	0.56
R1405:Arap1	UTSW	7	101398436	splice site	probably null
R1405:Arap1	UTSW	7	101398436	splice site	probably null
R1724:Arap1	UTSW	7	101400526	missense	possibly damaging	0.91
R1793:Arap1	UTSW	7	101388622	missense	probably benign
R1959:Arap1	UTSW	7	101373015	missense	probably damaging	1.00
R1960:Arap1	UTSW	7	101373015	missense	probably damaging	1.00
R2020:Arap1	UTSW	7	101401518	missense	probably benign	0.00
R2128:Arap1	UTSW	7	101409320	missense	probably damaging	1.00
R3737:Arap1	UTSW	7	101400277	missense	possibly damaging	0.85
R3851:Arap1	UTSW	7	101390165	nonsense	probably null
R4034:Arap1	UTSW	7	101400277	missense	possibly damaging	0.85
R4386:Arap1	UTSW	7	101385571	missense	probably benign
R4435:Arap1	UTSW	7	101390254	missense	possibly damaging	0.74
R4779:Arap1	UTSW	7	101404367	missense	probably damaging	1.00
R4786:Arap1	UTSW	7	101385005	missense	possibly damaging	0.94
R4850:Arap1	UTSW	7	101398791	missense	probably damaging	1.00
R4942:Arap1	UTSW	7	101401802	missense	possibly damaging	0.95
R5253:Arap1	UTSW	7	101388644	missense	probably benign	0.00
R5342:Arap1	UTSW	7	101404960	missense	probably benign	0.00
R5367:Arap1	UTSW	7	101409130	missense	probably damaging	0.99
R5397:Arap1	UTSW	7	101384912	missense	possibly damaging	0.95
R5968:Arap1	UTSW	7	101394738	missense	probably damaging	1.00
R6052:Arap1	UTSW	7	101404033	missense	probably damaging	1.00
R6574:Arap1	UTSW	7	101404001	missense	probably damaging	1.00
R6645:Arap1	UTSW	7	101408111	missense	possibly damaging	0.57
R7060:Arap1	UTSW	7	101409357	splice site	probably null
R7191:Arap1	UTSW	7	101384992	missense	probably benign	0.31
R7323:Arap1	UTSW	7	101400211	missense	probably damaging	1.00
R7349:Arap1	UTSW	7	101390228	missense	possibly damaging	0.95
R7516:Arap1	UTSW	7	101409331	missense	probably benign	0.00
R7922:Arap1	UTSW	7	101404414	nonsense	probably null
R8034:Arap1	UTSW	7	101394773	missense	probably damaging	1.00
R8293:Arap1	UTSW	7	101400934	missense	probably benign
R8493:Arap1	UTSW	7	101386518	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGGTGGTGAAGAAGTACCAGTCC -3'
(R):5'- GCGTGTGAGTGTCTGAGCACAAAG -3'

Sequencing Primer
(F):5'- CATGGAGGCCATGCTGTTG -3'
(R):5'- TACTAATGTCCATCACAGGGCTTAC -3'

Posted On

2014-01-15