Incidental Mutation 'R1186:Inpp5f'
ID 102128
Institutional Source Beutler Lab
Gene Symbol Inpp5f
Ensembl Gene ENSMUSG00000042105
Gene Name inositol polyphosphate-5-phosphatase F
Synonyms cI-27, 5830435P03Rik, SAC2
MMRRC Submission 039258-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock # R1186 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 128611328-128696425 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128694583 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 195 (I195T)
Ref Sequence ENSEMBL: ENSMUSP00000146197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043138] [ENSMUST00000057557] [ENSMUST00000118605] [ENSMUST00000119081] [ENSMUST00000151237] [ENSMUST00000202419]
AlphaFold Q8CDA1
Predicted Effect probably benign
Transcript: ENSMUST00000043138
AA Change: I886T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045910
Gene: ENSMUSG00000042105
AA Change: I886T

DomainStartEndE-ValueType
Pfam:Syja_N 49 416 1.2e-85 PFAM
Blast:IPPc 449 568 6e-13 BLAST
Pfam:hSac2 590 698 9.1e-25 PFAM
low complexity region 1042 1054 N/A INTRINSIC
low complexity region 1059 1065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057557
SMART Domains Protein: ENSMUSP00000062843
Gene: ENSMUSG00000048170

DomainStartEndE-ValueType
Pfam:MCM_bind 37 166 1.6e-44 PFAM
Pfam:Racemase_4 352 451 1.5e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118475
Predicted Effect probably benign
Transcript: ENSMUST00000118605
AA Change: I259T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113700
Gene: ENSMUSG00000042105
AA Change: I259T

DomainStartEndE-ValueType
Pfam:hSac2 1 73 8.9e-21 PFAM
low complexity region 415 427 N/A INTRINSIC
low complexity region 432 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119081
SMART Domains Protein: ENSMUSP00000113961
Gene: ENSMUSG00000048170

DomainStartEndE-ValueType
Pfam:MCM_bind 36 588 3.6e-210 PFAM
low complexity region 603 623 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142075
Predicted Effect probably benign
Transcript: ENSMUST00000151237
AA Change: I195T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000202419
SMART Domains Protein: ENSMUSP00000143952
Gene: ENSMUSG00000042105

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:VMA21 30 84 9.9e-9 PFAM
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase and contains a Sac domain. The activity of this protein is specific for phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased isoproterenol-induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Alpk2 T C 18: 65,294,341 probably null Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Ddx5 T C 11: 106,783,979 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Galnt17 G T 5: 131,111,742 T179K probably damaging Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Isyna1 C A 8: 70,595,201 N115K probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Med24 T C 11: 98,717,757 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1084 A T 2: 86,639,463 L82M probably damaging Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
P2rx7 T C 5: 122,670,451 Y299H probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Senp2 T C 16: 22,011,504 S38P probably damaging Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Spry2 A G 14: 105,892,907 C282R probably damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Usp46 C T 5: 74,002,122 A312T probably benign Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Vmn2r6 T A 3: 64,565,067 M78L probably benign Het
Zfp407 A T 18: 84,209,448 I2012N probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in Inpp5f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Inpp5f APN 7 128664267 missense probably benign 0.04
IGL01316:Inpp5f APN 7 128690706 splice site probably benign
IGL01455:Inpp5f APN 7 128678049 missense probably damaging 1.00
IGL01471:Inpp5f APN 7 128675398 missense probably damaging 0.99
IGL01590:Inpp5f APN 7 128664307 critical splice donor site probably null
IGL01942:Inpp5f APN 7 128667769 missense probably damaging 1.00
IGL02092:Inpp5f APN 7 128685224 missense probably damaging 1.00
IGL02137:Inpp5f APN 7 128695129 missense probably damaging 1.00
IGL02664:Inpp5f APN 7 128664014 missense probably damaging 1.00
IGL02812:Inpp5f APN 7 128682306 missense probably damaging 1.00
IGL02942:Inpp5f APN 7 128694900 missense probably benign 0.29
PIT4480001:Inpp5f UTSW 7 128685134 missense probably benign 0.32
PIT4812001:Inpp5f UTSW 7 128692308 missense probably benign 0.39
R0243:Inpp5f UTSW 7 128695183 missense probably damaging 1.00
R0346:Inpp5f UTSW 7 128690668 missense probably damaging 1.00
R1375:Inpp5f UTSW 7 128664029 nonsense probably null
R1918:Inpp5f UTSW 7 128663969 splice site probably benign
R2307:Inpp5f UTSW 7 128694310 missense probably damaging 1.00
R3716:Inpp5f UTSW 7 128690670 missense probably damaging 1.00
R4157:Inpp5f UTSW 7 128679699 intron probably benign
R4647:Inpp5f UTSW 7 128659109 missense possibly damaging 0.94
R4705:Inpp5f UTSW 7 128663987 missense probably damaging 0.97
R4713:Inpp5f UTSW 7 128663725 missense probably damaging 0.99
R4818:Inpp5f UTSW 7 128685129 missense probably damaging 1.00
R4914:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R4915:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R4917:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R5069:Inpp5f UTSW 7 128676727 critical splice acceptor site probably null
R5181:Inpp5f UTSW 7 128679831 missense probably damaging 1.00
R5234:Inpp5f UTSW 7 128663683 missense probably benign
R6299:Inpp5f UTSW 7 128636160 missense possibly damaging 0.87
R6389:Inpp5f UTSW 7 128678056 missense probably damaging 1.00
R6530:Inpp5f UTSW 7 128664078 nonsense probably null
R6545:Inpp5f UTSW 7 128694556 missense possibly damaging 0.88
R7259:Inpp5f UTSW 7 128669957 missense probably benign 0.00
R7383:Inpp5f UTSW 7 128694586 missense probably damaging 1.00
R7427:Inpp5f UTSW 7 128679805 missense probably damaging 1.00
R7428:Inpp5f UTSW 7 128679805 missense probably damaging 1.00
R7679:Inpp5f UTSW 7 128694523 missense possibly damaging 0.68
R7809:Inpp5f UTSW 7 128667643 missense probably damaging 1.00
R7840:Inpp5f UTSW 7 128694802 missense probably benign
R7912:Inpp5f UTSW 7 128692313 missense probably benign
R7915:Inpp5f UTSW 7 128667709 missense probably benign 0.25
R7960:Inpp5f UTSW 7 128693914 splice site probably null
R8027:Inpp5f UTSW 7 128690673 missense probably damaging 1.00
R8154:Inpp5f UTSW 7 128664267 missense possibly damaging 0.73
R8213:Inpp5f UTSW 7 128679805 missense probably damaging 1.00
R9499:Inpp5f UTSW 7 128693713 missense possibly damaging 0.62
R9519:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9544:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9597:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9598:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
RF001:Inpp5f UTSW 7 128695083 missense probably damaging 1.00
X0061:Inpp5f UTSW 7 128682297 missense probably damaging 1.00
Z1088:Inpp5f UTSW 7 128694949 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCCAATGTGAACATCGGCAACCTAC -3'
(R):5'- TTTTCTTCAGGGGAGACTCCAGGC -3'

Sequencing Primer
(F):5'- GTCAATCTTTGGAAGTCAGATAGTAG -3'
(R):5'- GGCCTTTCCCAAGTTCACTTC -3'
Posted On 2014-01-15