Mutagenetix > Incidental Mutation

Incidental Mutation 'R1186:Tex15'

102130

Institutional Source

Beutler Lab

Gene Symbol

Tex15

Ensembl Gene

ENSMUSG00000009628

Gene Name

testis expressed gene 15

Synonyms

2210014E14Rik

MMRRC Submission

039258-MU

Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene?

Probably non essential (E-score: 0.205) question?

Stock #

R1186 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33516738-33585582 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33571633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 364 (M364V)

Ref Sequence

ENSEMBL: ENSMUSP00000009772 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000009772
AA Change: M364V

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: M364V

Domain	Start	End	E-Value	Type
low complexity region	262	274	N/A	INTRINSIC
low complexity region	302	313	N/A	INTRINSIC
low complexity region	524	536	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	713	725	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1497	1508	N/A	INTRINSIC
Pfam:TEX15	1572	1788	1.3e-109	PFAM
Pfam:TEX15	1901	2119	1.1e-16	PFAM
low complexity region	2758	2770	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124496
AA Change: M638V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628
AA Change: M638V

Domain	Start	End	E-Value	Type
Pfam:DUF3715	89	251	1.6e-58	PFAM
low complexity region	536	548	N/A	INTRINSIC
low complexity region	576	587	N/A	INTRINSIC
low complexity region	798	810	N/A	INTRINSIC
low complexity region	939	948	N/A	INTRINSIC
low complexity region	987	999	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124501

SMART Domains

Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

Domain	Start	End	E-Value	Type
Pfam:DUF3715	96	251	2.4e-52	PFAM

Meta Mutation Damage Score

0.0673

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 95.7%
20x: 90.1%

Validation Efficiency

97% (69/71)

MGI Phenotype

Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	G	A	10: 21,621,652	R64Q	probably benign	Het
4932438A13Rik	T	C	3: 36,996,312		probably benign	Het
9530068E07Rik	G	A	11: 52,403,078	V49I	probably benign	Het
A2m	T	C	6: 121,661,534	S902P	probably benign	Het
Aatf	A	T	11: 84,470,549		probably benign	Het
Adamtsl1	A	G	4: 86,388,509	T1395A	probably benign	Het
Alpk2	T	C	18: 65,294,341		probably null	Het
Ank3	G	T	10: 69,867,460	A308S	probably damaging	Het
Arap1	A	G	7: 101,404,269		probably benign	Het
C4b	T	C	17: 34,736,309	D769G	possibly damaging	Het
Cep350	A	G	1: 155,875,376	S2017P	probably damaging	Het
Cfap54	T	A	10: 92,875,994	I2704F	unknown	Het
Crip2	G	A	12: 113,144,959		probably benign	Het
Cyp4f14	T	C	17: 32,916,786	I34V	probably benign	Het
Dcstamp	A	G	15: 39,754,629		probably null	Het
Ddx5	T	C	11: 106,783,979		probably null	Het
Dnah2	A	T	11: 69,515,700	L572Q	probably damaging	Het
Espl1	G	A	15: 102,304,039	A527T	probably benign	Het
Fam83d	A	G	2: 158,785,174	D261G	probably damaging	Het
Fbxo34	T	C	14: 47,530,586	F468L	probably damaging	Het
Gabarapl1	A	T	6: 129,533,405		probably benign	Het
Galnt17	G	T	5: 131,111,742	T179K	probably damaging	Het
Gm6768	A	C	12: 119,261,471		noncoding transcript	Het
Gm6899	C	T	11: 26,593,685		probably benign	Het
Helz2	T	A	2: 181,231,128	R2433W	probably damaging	Het
Hivep3	T	C	4: 119,814,723		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ica1	A	G	6: 8,672,326	L225P	probably damaging	Het
Inpp5f	T	C	7: 128,694,583	I195T	probably benign	Het
Isyna1	C	A	8: 70,595,201	N115K	probably benign	Het
Ly6g6e	T	C	17: 35,078,008	F75S	probably benign	Het
Ly96	A	G	1: 16,700,894	D101G	possibly damaging	Het
Mapk9	A	G	11: 49,878,269	T243A	probably damaging	Het
Mcc	A	G	18: 44,759,403	V48A	probably benign	Het
Mcpt2	C	T	14: 56,043,945		probably benign	Het
Med24	T	C	11: 98,717,757		probably benign	Het
Mtbp	G	A	15: 55,564,671	G162S	probably null	Het
Mtfr2	G	A	10: 20,352,852	C48Y	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Naip2	AGGG	AGG	13: 100,162,037		probably null	Het
Nup107	A	C	10: 117,777,146	Y292*	probably null	Het
Nwd2	C	T	5: 63,650,024		probably benign	Het
Nxpe4	A	C	9: 48,393,392	N260H	probably benign	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1084	A	T	2: 86,639,463	L82M	probably damaging	Het
Olfr5	T	C	7: 6,480,542	I205V	probably benign	Het
Olfr901	T	C	9: 38,431,101	V273A	possibly damaging	Het
Olfr911-ps1	T	C	9: 38,524,157	S142P	probably damaging	Het
P2rx7	T	C	5: 122,670,451	Y299H	probably damaging	Het
Per3	T	A	4: 151,026,138	E401V	probably damaging	Het
Rbm34	C	A	8: 126,965,447	E182*	probably null	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Senp2	T	C	16: 22,011,504	S38P	probably damaging	Het
Slc36a2	A	T	11: 55,164,231		probably null	Het
Spred1	A	T	2: 117,177,697	R361S	possibly damaging	Het
Spry2	A	G	14: 105,892,907	C282R	probably damaging	Het
Srp54b	T	C	12: 55,255,528		probably benign	Het
Taar8c	G	C	10: 24,101,565	Y116*	probably null	Het
Tchh	C	G	3: 93,448,046	R1598G	unknown	Het
Ttbk1	T	C	17: 46,467,131	R662G	probably damaging	Het
Ttc5	G	A	14: 50,767,226	Q374*	probably null	Het
Usp46	C	T	5: 74,002,122	A312T	probably benign	Het
Vmn1r176	A	T	7: 23,835,626	L34Q	probably damaging	Het
Vmn1r178	A	T	7: 23,893,892	R122*	probably null	Het
Vmn2r6	T	A	3: 64,565,067	M78L	probably benign	Het
Zfp407	A	T	18: 84,209,448	I2012N	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het
Zfyve26	G	A	12: 79,263,949	L161F	probably damaging	Het

Other mutations in Tex15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Tex15	APN	8	33575311	missense	probably benign	0.18
IGL00705:Tex15	APN	8	33581592	missense	probably damaging	1.00
IGL00820:Tex15	APN	8	33579006	splice site	probably benign
IGL01288:Tex15	APN	8	33571384	missense	probably benign	0.02
IGL01328:Tex15	APN	8	33571396	nonsense	probably null
IGL01359:Tex15	APN	8	33581898	missense	probably damaging	0.99
IGL01603:Tex15	APN	8	33573547	missense	possibly damaging	0.93
IGL01861:Tex15	APN	8	33570689	missense	probably damaging	1.00
IGL02052:Tex15	APN	8	33582465	missense	probably benign	0.28
IGL02560:Tex15	APN	8	33581751	missense	probably benign	0.00
IGL02677:Tex15	APN	8	33571080	missense	probably benign	0.03
IGL02739:Tex15	APN	8	33581693	missense	possibly damaging	0.68
Big_gulp	UTSW	8	33581734	missense	probably damaging	1.00
P0005:Tex15	UTSW	8	33570868	missense	probably benign	0.00
P0037:Tex15	UTSW	8	33581580	missense	probably benign	0.00
PIT4377001:Tex15	UTSW	8	33571101	missense	probably damaging	1.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0595:Tex15	UTSW	8	33572617	missense	probably damaging	1.00
R0646:Tex15	UTSW	8	33582326	missense	possibly damaging	0.83
R0688:Tex15	UTSW	8	33573500	missense	probably damaging	1.00
R0842:Tex15	UTSW	8	33571547	missense	possibly damaging	0.95
R0987:Tex15	UTSW	8	33576847	missense	probably damaging	1.00
R1084:Tex15	UTSW	8	33577004	missense	probably benign	0.28
R1183:Tex15	UTSW	8	33574865	missense	probably benign	0.35
R1378:Tex15	UTSW	8	33575216	missense	probably damaging	0.99
R1500:Tex15	UTSW	8	33575092	missense	probably damaging	0.96
R1508:Tex15	UTSW	8	33576852	missense	probably damaging	1.00
R1597:Tex15	UTSW	8	33571483	missense	probably damaging	0.96
R1636:Tex15	UTSW	8	33576387	nonsense	probably null
R1639:Tex15	UTSW	8	33570817	missense	possibly damaging	0.94
R1809:Tex15	UTSW	8	33574234	missense	probably benign
R1843:Tex15	UTSW	8	33576654	missense	probably benign	0.27
R2029:Tex15	UTSW	8	33571274	missense	probably damaging	0.99
R2228:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2229:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2245:Tex15	UTSW	8	33571496	missense	possibly damaging	0.77
R2246:Tex15	UTSW	8	33582512	missense	possibly damaging	0.49
R2880:Tex15	UTSW	8	33574907	nonsense	probably null
R2881:Tex15	UTSW	8	33574907	nonsense	probably null
R2882:Tex15	UTSW	8	33574907	nonsense	probably null
R3001:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3002:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3020:Tex15	UTSW	8	33576670	missense	probably damaging	1.00
R3084:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3085:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3701:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3702:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3752:Tex15	UTSW	8	33571415	missense	probably benign
R4162:Tex15	UTSW	8	33581558	missense	probably damaging	1.00
R4231:Tex15	UTSW	8	33572137	missense	probably damaging	0.99
R4589:Tex15	UTSW	8	33557373	missense	probably damaging	1.00
R4707:Tex15	UTSW	8	33582497	missense	probably benign	0.00
R4773:Tex15	UTSW	8	33582732	missense	probably benign	0.42
R4967:Tex15	UTSW	8	33574470	missense	probably benign	0.34
R5063:Tex15	UTSW	8	33582610	missense	possibly damaging	0.59
R5121:Tex15	UTSW	8	33571766	missense	probably damaging	1.00
R5147:Tex15	UTSW	8	33572312	nonsense	probably null
R5166:Tex15	UTSW	8	33576392	missense	probably benign	0.07
R5173:Tex15	UTSW	8	33571740	missense	possibly damaging	0.73
R5439:Tex15	UTSW	8	33574171	missense	possibly damaging	0.93
R5537:Tex15	UTSW	8	33571613	missense	probably damaging	1.00
R5580:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R5588:Tex15	UTSW	8	33577187	missense	probably damaging	1.00
R5696:Tex15	UTSW	8	33573192	missense	probably benign	0.01
R5734:Tex15	UTSW	8	33546336	missense	probably benign	0.01
R5756:Tex15	UTSW	8	33575833	missense	probably benign	0.17
R5823:Tex15	UTSW	8	33570934	missense	possibly damaging	0.67
R6126:Tex15	UTSW	8	33573563	missense	probably benign	0.19
R6129:Tex15	UTSW	8	33574130	missense	possibly damaging	0.90
R6276:Tex15	UTSW	8	33577189	missense	possibly damaging	0.93
R6374:Tex15	UTSW	8	33575912	missense	probably damaging	1.00
R6430:Tex15	UTSW	8	33571301	missense	probably benign	0.01
R6452:Tex15	UTSW	8	33572816	missense	probably damaging	1.00
R6471:Tex15	UTSW	8	33581734	missense	probably damaging	1.00
R6700:Tex15	UTSW	8	33574889	missense	possibly damaging	0.93
R6918:Tex15	UTSW	8	33573184	missense	probably benign	0.27
R6958:Tex15	UTSW	8	33570871	missense	probably benign	0.01
R6970:Tex15	UTSW	8	33557428	missense	probably benign	0.03
R7059:Tex15	UTSW	8	33574730	missense	possibly damaging	0.57
R7069:Tex15	UTSW	8	33570720	missense	probably benign
R7072:Tex15	UTSW	8	33575431	missense	possibly damaging	0.85
R7212:Tex15	UTSW	8	33570826	nonsense	probably null
R7212:Tex15	UTSW	8	33572995	missense	probably damaging	1.00
R7216:Tex15	UTSW	8	33572986	missense	possibly damaging	0.93
R7219:Tex15	UTSW	8	33546240	missense	probably benign	0.40
R7313:Tex15	UTSW	8	33574817	missense	possibly damaging	0.82
R7315:Tex15	UTSW	8	33581516	missense	probably benign	0.01
R7444:Tex15	UTSW	8	33576562	missense	possibly damaging	0.92
R7455:Tex15	UTSW	8	33576997	missense	possibly damaging	0.91
R7643:Tex15	UTSW	8	33575120	missense	probably damaging	1.00
R7644:Tex15	UTSW	8	33574417	missense	probably benign	0.01
R7724:Tex15	UTSW	8	33546263	missense	possibly damaging	0.60
R7779:Tex15	UTSW	8	33575281	missense	probably damaging	1.00
R7798:Tex15	UTSW	8	33581847	missense	possibly damaging	0.69
R7816:Tex15	UTSW	8	33581655	missense	probably benign	0.14
R7820:Tex15	UTSW	8	33575062	missense	probably damaging	0.98
R8041:Tex15	UTSW	8	33575846	missense	probably damaging	1.00
R8150:Tex15	UTSW	8	33573506	missense	probably benign	0.06
R8152:Tex15	UTSW	8	33572893	missense	possibly damaging	0.82
R8237:Tex15	UTSW	8	33577399	missense	possibly damaging	0.72
R8250:Tex15	UTSW	8	33565205	missense	probably null	0.27
R8264:Tex15	UTSW	8	33582362	missense	probably benign	0.18
R8279:Tex15	UTSW	8	33571737	missense	probably damaging	0.96
R8353:Tex15	UTSW	8	33576871	nonsense	probably null
R8388:Tex15	UTSW	8	33575209	missense	probably benign	0.00
R8432:Tex15	UTSW	8	33576544	missense	probably damaging	0.99
R8453:Tex15	UTSW	8	33576871	nonsense	probably null
R8489:Tex15	UTSW	8	33577546	missense	probably benign	0.02
R8670:Tex15	UTSW	8	33574718	missense	probably benign	0.19
R8703:Tex15	UTSW	8	33572696	missense	probably benign	0.00
R8871:Tex15	UTSW	8	33576964	missense	possibly damaging	0.62
R8945:Tex15	UTSW	8	33574696	missense	probably benign	0.00
R9104:Tex15	UTSW	8	33570922	missense	possibly damaging	0.86
R9132:Tex15	UTSW	8	33577526	missense	possibly damaging	0.84
R9207:Tex15	UTSW	8	33575756	missense	probably damaging	1.00
R9210:Tex15	UTSW	8	33574291	missense	possibly damaging	0.91
R9330:Tex15	UTSW	8	33575115	missense	probably benign	0.01
R9354:Tex15	UTSW	8	33573316	missense	possibly damaging	0.86
R9365:Tex15	UTSW	8	33574536	missense	possibly damaging	0.56
R9440:Tex15	UTSW	8	33582245	missense	possibly damaging	0.90
R9534:Tex15	UTSW	8	33570971	missense	probably benign	0.45
R9570:Tex15	UTSW	8	33577281	missense	probably damaging	0.96
R9574:Tex15	UTSW	8	33574481	missense	probably benign	0.09
R9618:Tex15	UTSW	8	33572369	missense	probably benign	0.35
RF005:Tex15	UTSW	8	33576677	missense	probably benign	0.05
X0020:Tex15	UTSW	8	33576579	missense	probably benign	0.03
X0065:Tex15	UTSW	8	33575517	nonsense	probably null
Z1088:Tex15	UTSW	8	33571315	missense	possibly damaging	0.89
Z1088:Tex15	UTSW	8	33571810	missense	possibly damaging	0.68
Z1088:Tex15	UTSW	8	33574870	missense	probably benign
Z1176:Tex15	UTSW	8	33574726	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- GAGTCACGGAACTCCGATGAATCAG -3'
(R):5'- CTTCATGCTCCAAAGAGTGTTGCG -3'

Sequencing Primer
(F):5'- GAAAATACTTGTAGCAACGACTCTC -3'
(R):5'- CCAATGCTGCACGATATAGTTC -3'

Posted On

2014-01-15