Incidental Mutation 'R1186:Med24'
ID 102166
Institutional Source Beutler Lab
Gene Symbol Med24
Ensembl Gene ENSMUSG00000017210
Gene Name mediator complex subunit 24
Synonyms Trap100, 100kDa, Thrap4, Pparb2, R75526, DRIP100, Gse2, D11Ertd307e
MMRRC Submission 039258-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1186 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 98704591-98729435 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) T to C at 98717757 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017354] [ENSMUST00000100500] [ENSMUST00000126565] [ENSMUST00000138750]
AlphaFold Q99K74
Predicted Effect probably benign
Transcript: ENSMUST00000017354
SMART Domains Protein: ENSMUSP00000017354
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 985 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000100500
AA Change: T190A
SMART Domains Protein: ENSMUSP00000098069
Gene: ENSMUSG00000017210
AA Change: T190A

DomainStartEndE-ValueType
Pfam:Med24_N 1 1004 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125064
Predicted Effect probably benign
Transcript: ENSMUST00000126565
SMART Domains Protein: ENSMUSP00000118820
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 90 5.6e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137328
Predicted Effect probably benign
Transcript: ENSMUST00000138750
SMART Domains Protein: ENSMUSP00000120002
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 46 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144048
Meta Mutation Damage Score 0.0814 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene may form a submodule of the mediator complex that magnifies the effects of activators on the general transcription machinery. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die prior to birth exhibiting abnormal heart development, neural tube defects, and anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Alpk2 T C 18: 65,294,341 probably null Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Ddx5 T C 11: 106,783,979 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Galnt17 G T 5: 131,111,742 T179K probably damaging Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Inpp5f T C 7: 128,694,583 I195T probably benign Het
Isyna1 C A 8: 70,595,201 N115K probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1084 A T 2: 86,639,463 L82M probably damaging Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
P2rx7 T C 5: 122,670,451 Y299H probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Senp2 T C 16: 22,011,504 S38P probably damaging Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Spry2 A G 14: 105,892,907 C282R probably damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Usp46 C T 5: 74,002,122 A312T probably benign Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Vmn2r6 T A 3: 64,565,067 M78L probably benign Het
Zfp407 A T 18: 84,209,448 I2012N probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in Med24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Med24 APN 11 98709682 missense probably damaging 0.99
IGL01960:Med24 APN 11 98707542 missense probably benign
IGL02119:Med24 APN 11 98728835 missense probably benign 0.14
IGL02681:Med24 APN 11 98709739 nonsense probably null
IGL03038:Med24 APN 11 98716184 missense possibly damaging 0.93
IGL03377:Med24 APN 11 98705136 missense possibly damaging 0.67
R1887:Med24 UTSW 11 98718816 critical splice donor site probably benign
R1888:Med24 UTSW 11 98707282 utr 3 prime probably benign
R1936:Med24 UTSW 11 98718816 critical splice donor site probably null
R2063:Med24 UTSW 11 98715646 missense probably damaging 0.98
R3895:Med24 UTSW 11 98706388 missense probably benign
R4328:Med24 UTSW 11 98707116 critical splice donor site probably null
R4751:Med24 UTSW 11 98706432 missense probably damaging 0.98
R5195:Med24 UTSW 11 98710281 missense possibly damaging 0.71
R5237:Med24 UTSW 11 98710783 missense probably damaging 0.98
R6047:Med24 UTSW 11 98707765 nonsense probably null
R6834:Med24 UTSW 11 98705024 splice site probably null
R6984:Med24 UTSW 11 98718542 missense possibly damaging 0.51
R7015:Med24 UTSW 11 98718852 missense possibly damaging 0.51
R7244:Med24 UTSW 11 98714397 splice site probably null
R7479:Med24 UTSW 11 98704961 missense possibly damaging 0.52
R7536:Med24 UTSW 11 98712621 missense possibly damaging 0.52
R7594:Med24 UTSW 11 98715097 missense probably damaging 0.98
R7667:Med24 UTSW 11 98713164 missense possibly damaging 0.71
R7745:Med24 UTSW 11 98704967 missense probably damaging 0.98
R8023:Med24 UTSW 11 98718495 critical splice donor site probably null
R8146:Med24 UTSW 11 98718114 missense probably benign 0.08
R8382:Med24 UTSW 11 98717711 missense unknown
R8442:Med24 UTSW 11 98707557 missense probably benign 0.32
R8806:Med24 UTSW 11 98705144 missense probably damaging 0.99
R9388:Med24 UTSW 11 98710067 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGGCTGACAGGCACTGAGTTTAAC -3'
(R):5'- GCTACACATCGCCAAACTAGAGGAG -3'

Sequencing Primer
(F):5'- TTCCAATCTTActccccaccag -3'
(R):5'- GGCCTGTATGTCCCCTGAC -3'
Posted On 2014-01-15